ID: 1062794674

View in Genome Browser
Species Human (GRCh38)
Location 10:335592-335614
Sequence TCCAATCAGTCCCCTAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062794670_1062794674 11 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794674 10:335592-335614 TCCAATCAGTCCCCTAACTTGGG No data
1062794667_1062794674 28 Left 1062794667 10:335541-335563 CCGTGACTCTCACGACACCAGGC No data
Right 1062794674 10:335592-335614 TCCAATCAGTCCCCTAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062794674 Original CRISPR TCCAATCAGTCCCCTAACTT GGG Intronic