ID: 1062794676 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:335593-335615 |
| Sequence | CCAATCAGTCCCCTAACTTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062794670_1062794676 | 12 | Left | 1062794670 | 10:335558-335580 | CCAGGCTTTGGGAAGATTCTAGG | No data | ||
| Right | 1062794676 | 10:335593-335615 | CCAATCAGTCCCCTAACTTGGGG | No data | ||||
| 1062794667_1062794676 | 29 | Left | 1062794667 | 10:335541-335563 | CCGTGACTCTCACGACACCAGGC | No data | ||
| Right | 1062794676 | 10:335593-335615 | CCAATCAGTCCCCTAACTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062794676 | Original CRISPR | CCAATCAGTCCCCTAACTTG GGG | Intronic | ||