ID: 1062794677

View in Genome Browser
Species Human (GRCh38)
Location 10:335594-335616
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062794667_1062794677 30 Left 1062794667 10:335541-335563 CCGTGACTCTCACGACACCAGGC No data
Right 1062794677 10:335594-335616 CAATCAGTCCCCTAACTTGGGGG No data
1062794670_1062794677 13 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794677 10:335594-335616 CAATCAGTCCCCTAACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type