ID: 1062794682

View in Genome Browser
Species Human (GRCh38)
Location 10:335611-335633
Sequence TGGGGGCTGGTGCTTCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062794670_1062794682 30 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794682 10:335611-335633 TGGGGGCTGGTGCTTCCACATGG No data
1062794675_1062794682 -5 Left 1062794675 10:335593-335615 CCAATCAGTCCCCTAACTTGGGG No data
Right 1062794682 10:335611-335633 TGGGGGCTGGTGCTTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062794682 Original CRISPR TGGGGGCTGGTGCTTCCACA TGG Intronic