ID: 1062799633

View in Genome Browser
Species Human (GRCh38)
Location 10:369518-369540
Sequence GCTGTCCGTGCTCACCGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062799633_1062799639 26 Left 1062799633 10:369518-369540 CCTGCACGGTGAGCACGGACAGC 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1062799639 10:369567-369589 CCCATAGGTCAGTCCATGCATGG 0: 1
1: 0
2: 0
3: 6
4: 111
1062799633_1062799635 11 Left 1062799633 10:369518-369540 CCTGCACGGTGAGCACGGACAGC 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1062799635 10:369552-369574 GTCCACACGAATGACCCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062799633 Original CRISPR GCTGTCCGTGCTCACCGTGC AGG (reversed) Exonic
900778425 1:4601325-4601347 ACTGTGAGTGCTCACCGTCCTGG + Intergenic
902360012 1:15937252-15937274 GCTGGCCGGGCTGACCGAGCTGG - Exonic
904471595 1:30739862-30739884 CCTGTGCCTGCTCACCCTGCTGG - Exonic
904654960 1:32037956-32037978 GCTGTCCGTGCTCTTGGTGCTGG - Exonic
905884994 1:41486973-41486995 GCTGGCTGTGCTGACCCTGCGGG - Intergenic
915715633 1:157942074-157942096 GCTTACTGTGCTCACTGTGCTGG - Intergenic
920493819 1:206439877-206439899 GCTGTCCGTGTTGCCCCTGCTGG + Intronic
922041906 1:221904968-221904990 GCTGTCTCTACTCACAGTGCAGG - Intergenic
924600369 1:245483358-245483380 GCTGTCCGAGGTCACCCAGCTGG + Intronic
1062799633 10:369518-369540 GCTGTCCGTGCTCACCGTGCAGG - Exonic
1062860832 10:807851-807873 GCTGTCCCTCCTCTCCGTGGTGG + Exonic
1070305350 10:75235886-75235908 GCTCTCCGTGCCCGCCGCGCTGG - Exonic
1071858141 10:89646047-89646069 ACTGTCCATGCTCACTATGCAGG + Intergenic
1074531983 10:114304686-114304708 GCTGGCCCTGCTCCCCCTGCAGG + Intronic
1077033940 11:485468-485490 GGTGTGTGTGCTCACTGTGCAGG + Intronic
1079097332 11:17519297-17519319 GCTGTCCCAGCTCAGCGGGCAGG + Intronic
1083923445 11:65792492-65792514 GCTGTCTGTGCCCACAGGGCTGG - Intronic
1088543795 11:110939956-110939978 GCTGTCCGTGATAACCCTTCTGG + Intergenic
1089326056 11:117657939-117657961 GCAGTCTGTGCTCATTGTGCTGG - Intronic
1089604654 11:119634951-119634973 GCTGTCCGTGCTCACAACACCGG + Intronic
1090119945 11:124015667-124015689 GGTTTACGTGCTCACTGTGCTGG + Exonic
1090120590 11:124023105-124023127 GGTTTACGTGCTCACTGTGCTGG + Exonic
1090121159 11:124029715-124029737 GGTTTACGTGCTCACTGTGCTGG + Exonic
1090121922 11:124038887-124038909 GGTTTACGTGCTCACTGTGCTGG - Exonic
1094498710 12:31005349-31005371 GCTGTCCGTGGCCACTGTGGGGG - Intergenic
1097382791 12:58915707-58915729 GCTGTGCATGCTCACCACGCTGG + Intronic
1099420245 12:82449400-82449422 GCTGCCCATGCACACCGTCCTGG + Intronic
1104064304 12:125294128-125294150 GCTGTCTATGCTCACAGTGGTGG - Intronic
1106299375 13:28450126-28450148 ACTGTCCGTGTGCACAGTGCTGG - Intronic
1113945578 13:114042306-114042328 GCCGTGGGTGCTCACCGTGGTGG - Intronic
1122291432 14:100682368-100682390 GCTGTCTCTGCTCAACGTGCTGG + Intergenic
1123696440 15:22882235-22882257 GCTGGCAGTGCTCACGATGCTGG - Intronic
1124664399 15:31580104-31580126 CCTCTCCCTGCTCACCCTGCTGG - Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130651916 15:85766896-85766918 GCTGTCTGTTCCCACCATGCAGG + Intronic
1132549752 16:549481-549503 GCCGCCCGTGCCCACCCTGCAGG - Intronic
1132844111 16:1992222-1992244 GCTCTCCGCGCTCACCGCCCCGG - Intronic
1137033982 16:35553059-35553081 GCCGTCCGTGCCCGCCCTGCCGG + Intergenic
1141441678 16:84033380-84033402 CCTGCCCCTGCTCTCCGTGCTGG - Exonic
1142190638 16:88715823-88715845 GCTGTACGTGTCCATCGTGCTGG - Exonic
1142390655 16:89797489-89797511 GCTGTCCTTCCTCACAGGGCAGG + Intronic
1144846736 17:18224215-18224237 GCTGTCCCTGCTGCCTGTGCTGG + Intergenic
1152662875 17:81551085-81551107 GCTGTGCGCGTTCACCTTGCTGG - Exonic
1157451423 18:47792014-47792036 GCTGCCCCTGCTCACCTTCCTGG + Intergenic
1158660024 18:59378694-59378716 GATGTCCCTTCTCCCCGTGCTGG - Intergenic
1160893090 19:1389695-1389717 GCTGCACGTGCTCACGCTGCAGG - Intronic
1161076917 19:2290273-2290295 GCTGACCGTGCGCCCCGAGCCGG - Exonic
1165342843 19:35224902-35224924 GCTGCTCGTGGTCACCGTCCTGG - Exonic
1166542129 19:43612393-43612415 GGTGTCGGTGCTCACCCTGCTGG - Exonic
1168076584 19:53983516-53983538 GTGCTCCGTGCTCAGCGTGCAGG + Exonic
1168530450 19:57124065-57124087 GCTGTCCATGGTCACACTGCAGG - Exonic
926120599 2:10239421-10239443 GCTGGCCGTGCTGGCCGGGCTGG + Intergenic
926123533 2:10257535-10257557 GATGTCCGTGTGCACGGTGCAGG - Intergenic
928528443 2:32165728-32165750 GCTGTCCCTGCACTCCGTGGCGG - Intergenic
930873897 2:56192841-56192863 GCTGTCAGTGCTGCCAGTGCTGG - Exonic
933770501 2:85741211-85741233 GCTGTCGGTGCTCAGCTTGATGG - Intergenic
935657612 2:105438429-105438451 GCTGTCCCTGCTCATCGGGCTGG - Intronic
937332635 2:121041865-121041887 GCTGTCCGTGCTCAGCACTCTGG - Intergenic
938341841 2:130541148-130541170 GCTGCCCGTGCCCAGCGTGGGGG + Intronic
938347989 2:130579563-130579585 GCTGCCCGTGCCCAGCGTGGGGG - Intronic
942452442 2:176116632-176116654 GTTGTCCGTGCTTACCCGGCCGG + Exonic
942519326 2:176786903-176786925 GCAGAACGTGCTCACAGTGCTGG + Intergenic
948118470 2:235511337-235511359 GGTGTCCTTGCTCACCGAGAGGG - Intronic
948760638 2:240188396-240188418 GCTGCCCGTTCTCACAGTGCAGG - Intergenic
1172155869 20:32823961-32823983 GCTCTCCTTGCTCACTGGGCTGG + Intronic
1173825350 20:46044586-46044608 GCTGTGAGTGCTCACTGTCCTGG + Intronic
1175773731 20:61640254-61640276 GCTGTGCGTGCTCTCTGAGCTGG - Intronic
1175965249 20:62657089-62657111 GCTGTCCGCACACACCGCGCCGG - Exonic
1176111728 20:63413998-63414020 GCTGCCGGTGCTCATGGTGCTGG - Intronic
1180709537 22:17830573-17830595 GCTGTGCATGCTCACTCTGCTGG + Intronic
1181863699 22:25839355-25839377 CCTGGCCGTGCTCACCCTGCAGG + Intronic
1181875323 22:25935926-25935948 GCAGTCCTGGCTCACCCTGCGGG + Intronic
950613620 3:14141666-14141688 GCTGACCCTGCTGACCGTGGCGG + Exonic
953137066 3:40190306-40190328 GCTGTCCGAGGTCTCCCTGCTGG - Exonic
953987170 3:47453214-47453236 GCTGTCCATGCTGACCATGTGGG - Intronic
954293779 3:49663093-49663115 GCCGCCCGTGGTCACCGTGCCGG - Exonic
956501636 3:69893043-69893065 GCTGTACTTGGTCATCGTGCTGG - Intronic
965186335 3:165469224-165469246 TCTTTCCGTGCTCATCTTGCGGG + Intergenic
968869159 4:3232756-3232778 GCTGTCACGGCTCACTGTGCGGG - Intronic
969301801 4:6301421-6301443 GCTCTCCGTGGTCATCCTGCTGG + Exonic
986758561 5:10859367-10859389 GCTGTCCGTGCCCACCACCCTGG - Intergenic
995512309 5:112921751-112921773 GCCGTCCGCGCCCACCGCGCAGG + Intronic
1005415779 6:25598972-25598994 GATGTCACTGCTCACTGTGCAGG + Intronic
1006609857 6:35287838-35287860 GCTGTGCGTGCTCACCTTGCTGG - Exonic
1013539046 6:111088923-111088945 GTTGACCGCGCTCACCTTGCAGG - Intronic
1023895581 7:44430348-44430370 GCTGTCAGTGCTCACCTAGAAGG - Intronic
1024043900 7:45574735-45574757 GCTGGCCGTTCTCAGCCTGCTGG + Exonic
1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG + Exonic
1024337459 7:48224098-48224120 GCTGTCTGTTCCCACCCTGCTGG + Intronic
1032079998 7:128854046-128854068 GATCTCCGTGCGCTCCGTGCGGG - Exonic
1032092343 7:128917261-128917283 GCTGACCTGGCTCACAGTGCAGG - Intergenic
1032237977 7:130141125-130141147 GCTCCCCGTGCACACCGGGCGGG - Intergenic
1035751495 8:2000354-2000376 GCTGTCCTCGCTCACGGGGCAGG - Exonic
1035894798 8:3387444-3387466 GCTGTCTCTGCACACCCTGCTGG + Intronic
1036195406 8:6708996-6709018 GCGGCACGTGCTCTCCGTGCTGG - Intronic
1042127218 8:65550354-65550376 GCTCTCCGTACACACCCTGCAGG + Intergenic
1056288440 9:85115026-85115048 GCTGTCAGTCCTCACAGTGGTGG - Intergenic
1059447777 9:114349553-114349575 GGTCTCCGTTCTCACCCTGCCGG + Intronic
1061149084 9:128818801-128818823 GCTGCCCGTGCTGCCCGTGGCGG + Exonic
1061639752 9:131943434-131943456 GCTAGCCGTGCTCACCGTCTCGG - Intronic
1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG + Intergenic