ID: 1062800325

View in Genome Browser
Species Human (GRCh38)
Location 10:374428-374450
Sequence ACAGGGTTGCTGTGCAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062800325_1062800340 28 Left 1062800325 10:374428-374450 CCTATTCTGCACAGCAACCCTGT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1062800340 10:374479-374501 CTGTTTAGCAGACAGGGGCAGGG No data
1062800325_1062800339 27 Left 1062800325 10:374428-374450 CCTATTCTGCACAGCAACCCTGT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1062800339 10:374478-374500 CCTGTTTAGCAGACAGGGGCAGG No data
1062800325_1062800341 29 Left 1062800325 10:374428-374450 CCTATTCTGCACAGCAACCCTGT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1062800341 10:374480-374502 TGTTTAGCAGACAGGGGCAGGGG No data
1062800325_1062800332 21 Left 1062800325 10:374428-374450 CCTATTCTGCACAGCAACCCTGT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1062800332 10:374472-374494 ACCCTCCCTGTTTAGCAGACAGG No data
1062800325_1062800334 22 Left 1062800325 10:374428-374450 CCTATTCTGCACAGCAACCCTGT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1062800334 10:374473-374495 CCCTCCCTGTTTAGCAGACAGGG No data
1062800325_1062800336 23 Left 1062800325 10:374428-374450 CCTATTCTGCACAGCAACCCTGT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1062800336 10:374474-374496 CCTCCCTGTTTAGCAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062800325 Original CRISPR ACAGGGTTGCTGTGCAGAAT AGG (reversed) Intronic
902380573 1:16050502-16050524 ACAGGCTTGCTGTGGGGGATGGG - Exonic
902581366 1:17409771-17409793 ACAGGGTTGCTGGCCAGGCTGGG - Intronic
903731794 1:25501859-25501881 ACAGAGTTGCTATGGAGACTGGG + Intergenic
903765722 1:25732980-25733002 ACAGGGTTGCAGTGCTGTCTTGG - Intronic
904132288 1:28283867-28283889 ACAGGGTTGTTGTGAAGATTGGG - Intergenic
905861836 1:41357314-41357336 AATGGGATGGTGTGCAGAATGGG + Intergenic
906091751 1:43185456-43185478 GCAGGATTGCTGAGCAGAAATGG + Intronic
906481941 1:46204739-46204761 ACAGCCTTGCTCTGGAGAATTGG - Intronic
910450216 1:87336038-87336060 AGAGGGGGGCTGTGCATAATAGG - Intronic
910700072 1:90063840-90063862 CCAGGGTTGATGGGCACAATGGG + Intergenic
913114341 1:115682788-115682810 AAAGGGTTGCTTTTCAAAATTGG + Intronic
914747891 1:150512788-150512810 ACAGGCCTGCTGTGCAGAGGAGG + Exonic
917234040 1:172871461-172871483 ATAGGGCTTTTGTGCAGAATAGG - Intergenic
919275409 1:195408937-195408959 CCAGGGTTGCTGGGTTGAATAGG - Intergenic
919912137 1:202118097-202118119 ACAGGCTTGTTGTGAAGATTAGG - Intergenic
922345806 1:224695501-224695523 ACAGGGTTGCTGTGAAGGTTCGG - Intronic
922586001 1:226735947-226735969 ACAGGGTGGGTGTGCAGCCTGGG - Exonic
923554473 1:234989953-234989975 ACAGGGTGGCAGTGCAGAAATGG + Intergenic
1062800325 10:374428-374450 ACAGGGTTGCTGTGCAGAATAGG - Intronic
1063070239 10:2654548-2654570 AAAGGGTTTCTGGGAAGAATGGG + Intergenic
1070754073 10:78980857-78980879 AAAGGGCTGCTCTGCAGAAGCGG - Intergenic
1071309911 10:84333350-84333372 CTAGGGTTGCTGTGAAGATTAGG - Intronic
1075398217 10:122142896-122142918 ACAGGCTTGCAGTGCAGAAGAGG - Intronic
1078443072 11:11383505-11383527 ATAGGCTTGCTGTGGAGAACCGG + Intronic
1079098961 11:17528882-17528904 GCAGGGTTGTTGTGAAAAATAGG - Intronic
1079955071 11:26852225-26852247 ACAGGGTTGCTGTGAAAATGGGG + Intergenic
1082118604 11:48355163-48355185 ATATGGTTGCTCTGAAGAATGGG + Intergenic
1083057415 11:59835973-59835995 CCAGGGTTGCTGGGTAGAGTTGG + Exonic
1083690077 11:64402448-64402470 ACAGGGTTACTGTACTGACTGGG + Intergenic
1085829082 11:79880518-79880540 AAAGGGTGGGGGTGCAGAATGGG + Intergenic
1088403270 11:109444121-109444143 ACAGAGTTGGTGAGCAAAATGGG + Intergenic
1091652097 12:2318378-2318400 ACAGGGTTGCCCTGCACAATAGG - Intronic
1096520997 12:52184436-52184458 ACAGGTTTGCTGAACTGAATTGG - Intronic
1096581020 12:52585354-52585376 GCAGGGCTATTGTGCAGAATAGG + Intergenic
1097759008 12:63438900-63438922 AGAAGGTGGCTGTGCAAAATGGG - Intergenic
1102423196 12:112820366-112820388 CCAGGATTGTTGTGAAGAATGGG - Intronic
1104324684 12:127785139-127785161 AAAGGGGTGCTGTGCAGATGGGG + Intergenic
1105563840 13:21523247-21523269 AGAGGTTGGCTGTGAAGAATTGG - Intronic
1106931264 13:34668364-34668386 ACAGAGTAGCTGTCCAGAAAAGG + Intergenic
1107812053 13:44209930-44209952 ACAGGGTTGTTGTGAAGATAAGG - Intergenic
1110520374 13:76469169-76469191 ACATGGTTTCTGTGCAGGCTGGG - Intergenic
1112296805 13:98195021-98195043 ATAGGGTCGTTGTGTAGAATCGG + Intronic
1118136655 14:63035867-63035889 ACAGGGTTGCTCAGAAGATTTGG - Intronic
1119142027 14:72275988-72276010 ACTGGGTAGCAGGGCAGAATTGG + Intronic
1121265996 14:92603050-92603072 GCAGGCTTGCAGTGCAGAGTAGG - Intronic
1122145867 14:99688541-99688563 ACAGGGTTGCTGAGCAGAGGGGG - Intronic
1123101625 14:105806064-105806086 TCAGGGTTTCTGTGCACAACAGG + Intergenic
1125305379 15:38306446-38306468 ACAATTTTGCTGTGAAGAATTGG + Intronic
1125994500 15:44144904-44144926 GCAGGGTTGGTATGCAGGATAGG + Intronic
1126066655 15:44830805-44830827 TCAGGGCTGTTGTGCAGATTAGG + Intergenic
1127014355 15:54666559-54666581 ACAAGTATGGTGTGCAGAATGGG + Intergenic
1128708238 15:69852806-69852828 TCAGGGTTCCTCTGCAGAATGGG + Intergenic
1128923631 15:71634239-71634261 ACTGGGTTGCTGTGAGGATTAGG + Intronic
1129797369 15:78388421-78388443 ACAGCGCTGCTGTACAGAATTGG + Intergenic
1131500214 15:92956092-92956114 TCAGGGTTGGGGTGGAGAATAGG + Intronic
1133862275 16:9607208-9607230 ACAGTTTTGCTCTGTAGAATAGG - Intergenic
1133908958 16:10047609-10047631 TCAGGGTGGCTTTGCAGAAATGG - Intronic
1135974857 16:27101814-27101836 ACAGGGCTGCTGTGAGGACTGGG + Intergenic
1137597320 16:49733617-49733639 GGAGGGTGGCTGTGCAGAAAGGG + Intronic
1137772281 16:51025923-51025945 ACAGGGAGGCTCTGCAGGATTGG + Intergenic
1139505453 16:67396164-67396186 TCAGGGTTGCTGTGAAGATCAGG - Intronic
1140602280 16:76491450-76491472 ACAGGGTTGCAGTGATGATTGGG + Intronic
1144366481 17:14549600-14549622 CCAGGGTGGCTGTGTTGAATGGG + Intergenic
1145924863 17:28639179-28639201 ACAGGATTGCTGTTGAGACTCGG + Intronic
1146676973 17:34780463-34780485 AGAGAGGTGCTGTGCAGAACAGG - Intergenic
1148245069 17:46025077-46025099 ACAGGGTTTCTGTGGAGCAGAGG - Exonic
1148737047 17:49870831-49870853 ACAGGGTGGCTGAGCAGGAAGGG - Intergenic
1150548400 17:66186685-66186707 ACAGGGTTGCTGGGAAAAAATGG + Intronic
1151177539 17:72301099-72301121 AGAAGGTGGCTTTGCAGAATTGG + Intergenic
1152738658 17:82009442-82009464 ACAGGGCTTCTGGTCAGAATGGG - Intronic
1153766493 18:8379414-8379436 AAAGGGCTGGTGAGCAGAATGGG - Intronic
1157592835 18:48845933-48845955 AGAAGGTTGCTGTGCAAAATTGG - Intronic
1157949770 18:52022682-52022704 ACAGGGTTGATTTGAAGAAGTGG - Intergenic
1159026005 18:63182689-63182711 GCAGAGTTGATTTGCAGAATGGG - Intronic
1161064738 19:2232062-2232084 GCAGGGTGGCTGTGGAGACTGGG + Exonic
925031690 2:654754-654776 ACAGGGTTGTTGTGATGAAATGG + Intergenic
926209257 2:10857078-10857100 ACAGGGTTGTTGTAAAGAATAGG + Intergenic
928016603 2:27663696-27663718 ATCGGGATGCTGTGCAGAACGGG - Exonic
934080818 2:88466364-88466386 ACAGGGCTGCTGTGAATGATTGG - Intergenic
935012546 2:99149295-99149317 ACAGGCTTCCTGTACAGAAAAGG - Intronic
936155451 2:110043779-110043801 ACAGCATTGCTGTGCAGAGCTGG - Intergenic
936189235 2:110327655-110327677 ACAGCATTGCTGTGCAGAGCTGG + Intergenic
936658344 2:114514246-114514268 ACAGGGTTGGTGGGGAGATTAGG - Intronic
937749918 2:125462994-125463016 ACAGCTTTGTTGTGCAAAATTGG - Intergenic
938408389 2:131045209-131045231 GCAGGCTGACTGTGCAGAATGGG + Intronic
940292383 2:152089942-152089964 AGAGGGTCACTGAGCAGAATGGG + Intronic
940498566 2:154465405-154465427 ACAGGATTGGTGAGTAGAATAGG + Intergenic
943984559 2:194603440-194603462 ACAGGCTTGCTGGGGAGAACAGG + Intergenic
946413508 2:219527369-219527391 TCAAGGTGGCTGTGCAGAGTCGG - Intronic
947442655 2:230136699-230136721 ACTGGGATTCTGGGCAGAATGGG + Intergenic
948400477 2:237681288-237681310 ACAGGGCTGCTCTGCCGAAGTGG - Intronic
948723420 2:239917950-239917972 CCTGGGCTGCAGTGCAGAATGGG + Intronic
1171210940 20:23316514-23316536 TCAGGGTTGCTGTGAAGCTTAGG - Intergenic
1175759178 20:61549860-61549882 ACAGGTTTGCTTTGCAGAATGGG + Intronic
1178420788 21:32441742-32441764 AGAGGGTTGGTGTACAGAAAGGG + Intronic
1178802121 21:35805906-35805928 ACAAGGCTGCTGTACAGAGTAGG - Intronic
1180099753 21:45579024-45579046 CCAGGGGTGCTGTGCACAAGAGG - Intergenic
1181138631 22:20787326-20787348 TCAGGTTTGCTGTGAAGAGTGGG - Exonic
1183304292 22:37074070-37074092 ACAGGGTTGCTGTGAAACTTTGG - Intronic
1183973227 22:41494298-41494320 ACTGGGTGGCTGTGAAGATTAGG + Intronic
1184783055 22:46658669-46658691 ACTGGGTGGATGTACAGAATGGG - Intronic
950867135 3:16198142-16198164 ACAGGGTGGCAATGCAGTATTGG + Intronic
950988524 3:17404383-17404405 TCAGGGTTGCAGTGGGGAATTGG - Intronic
952276220 3:31879871-31879893 TCTGCTTTGCTGTGCAGAATAGG - Intronic
953381553 3:42476415-42476437 ATAGGGCTGCTGAGCAGAAGTGG - Intergenic
953605599 3:44411318-44411340 ACAGAACTGCTGTGCAGATTGGG + Intergenic
957373299 3:79324369-79324391 ACAAGGTTGATGTACAGAAATGG + Intronic
960044046 3:113179283-113179305 GCAAGGTTGGTGTGAAGAATGGG - Intergenic
960715092 3:120567441-120567463 CTAGGGTTACTGAGCAGAATTGG - Intergenic
960941119 3:122935467-122935489 AAAGGATTGCTGTTCAGGATGGG + Intronic
961598658 3:128041812-128041834 ACAAGGTTCCTCTGTAGAATGGG + Intergenic
965155593 3:165049186-165049208 GCATGGATGCTGTGCAGAACTGG - Exonic
967002910 3:185353959-185353981 AGAGGGTGGCAGTGCAGACTGGG + Intronic
968226963 3:196978836-196978858 ACTGGGTGGCTCCGCAGAATTGG + Intergenic
968271052 3:197404119-197404141 ACAAGGGTGCTGTGCAGGGTGGG + Intergenic
969861548 4:10039745-10039767 CCAGGGATGCTGTAGAGAATTGG - Intronic
970338144 4:15074617-15074639 ACAGAATTGCTATGCAGATTAGG + Intergenic
970421178 4:15906750-15906772 ACAGGTTTGAAGGGCAGAATTGG - Intergenic
974001720 4:56518382-56518404 ACATGGCTGCTGTGGACAATGGG + Intronic
979307006 4:119158023-119158045 ACAGTATTGCTATGCAGAATGGG + Exonic
983007921 4:162508108-162508130 ACTTGGCTGCTGTGCGGAATAGG + Intergenic
984330873 4:178316235-178316257 ACAGGCTTGCAGTGTACAATAGG + Intergenic
985957008 5:3273184-3273206 TCAGGTTTGCTGTGCAGAGCTGG + Intergenic
986344456 5:6822016-6822038 ACAGGGTTGCAAGGCAGAAGTGG - Intergenic
987115734 5:14725272-14725294 ACAGGGATGCTGTGTGGACTGGG + Intronic
987140762 5:14943676-14943698 ACAGAGGTGCTGAGCAGAAGCGG - Intergenic
987237406 5:15957025-15957047 ACAGGTTTGTGGTGGAGAATGGG + Intergenic
987506131 5:18775502-18775524 ACAGGTATGCTGAGCAGAATGGG - Intergenic
988124061 5:27006094-27006116 AGAGGTTTGCTGTACAGATTAGG - Intronic
988540565 5:32104833-32104855 AAAGGGTTGATATCCAGAATAGG + Intronic
988906744 5:35798331-35798353 TCAGTGTGGCTGAGCAGAATTGG - Intronic
989178459 5:38553322-38553344 TCAGGGTTGCATGGCAGAATGGG - Intronic
990162559 5:52958130-52958152 ACAGAATAGCTGTGCAGAAGGGG + Exonic
990693905 5:58393557-58393579 ACAGGGTTGCTGTGATAACTAGG - Intergenic
993043221 5:82838575-82838597 ACAGGGTTGTTGTGAATATTGGG + Intergenic
997735834 5:136212160-136212182 ACAGGGTTGCTGTGAGGATCCGG + Intergenic
1001722634 5:173869129-173869151 ATAGAGCTGCAGTGCAGAATAGG - Intergenic
1004126588 6:12880076-12880098 AAAGGGTTGCTGTGAAGTTTAGG - Intronic
1007636330 6:43301984-43302006 TCAGGGTTGCTGTGAAAATTAGG + Intronic
1008382661 6:50851491-50851513 ACAGGTCTACTGCGCAGAATAGG + Intergenic
1015729754 6:136335516-136335538 GCAGGGGGGCTGAGCAGAATGGG + Intergenic
1018223570 6:161606178-161606200 GCAGGGTTGGTGTGAAGAACAGG + Intronic
1018376612 6:163219006-163219028 ATAGGGTTGCTGGACAGAACAGG - Intronic
1018833864 6:167468836-167468858 ACAGGGTTGATGAGGAAAATGGG + Intergenic
1020604155 7:10314989-10315011 GCAGAGTTTATGTGCAGAATTGG - Intergenic
1020809704 7:12836043-12836065 ACAGAGTTGCTTTGAAAAATGGG - Intergenic
1023320701 7:38994566-38994588 ACAGGGTTGGTGAGCAGAGCTGG + Intronic
1023617564 7:42035489-42035511 AGAGGGGTGATGTGCAAAATGGG + Intronic
1023882179 7:44326645-44326667 CCAGGGCTGCTGTCCAGAACCGG + Intronic
1025077353 7:55954415-55954437 ACAGGGTTGTTATAAAGAATAGG + Intronic
1032616892 7:133482548-133482570 ATAGGGTGGCAGTGCAGAGTAGG + Intronic
1034819529 7:154204035-154204057 ACAGGATTGCTATGGAAAATCGG - Intronic
1036049058 8:5175431-5175453 ACAGGTTTGAAGTGCATAATTGG + Intergenic
1036945977 8:13095310-13095332 ACAGGGTTTGCCTGCAGAATTGG - Intronic
1038020843 8:23550870-23550892 CCAGGGCTGCTGTGGAGCATGGG + Intronic
1040051810 8:43022412-43022434 ACAGGGTTGCTGTGTTGGGTTGG + Exonic
1041995164 8:64046546-64046568 ACAGGGTTGCAGAGCAAATTTGG - Intergenic
1044719598 8:95133315-95133337 AAAGGATTGCTGTGCTAAATGGG + Intergenic
1045001197 8:97879574-97879596 ACAGGGGAGCTGTGCAGAGGTGG + Intronic
1045142644 8:99303324-99303346 AAAGTGTTGCTGTGAACAATGGG + Intronic
1047432590 8:124805584-124805606 ACAGTGTTGCCCTCCAGAATAGG - Intergenic
1048844922 8:138597159-138597181 TCCGGGTTGCTGTGTAAAATGGG - Intronic
1048986287 8:139736884-139736906 GCAGGGTGGCTGTGGAGAGTGGG - Intronic
1049599793 8:143502141-143502163 ACCAGGTTGCTGGGCAGACTTGG - Intronic
1049698650 8:143996367-143996389 ACAGCGTTGCTTTGCAGGGTGGG - Intronic
1057872832 9:98731186-98731208 ACAGGGTTCCTGTGAAGATGAGG + Intergenic
1058346627 9:103971432-103971454 ACAGGATGCATGTGCAGAATGGG + Intergenic
1059844835 9:118263518-118263540 CCAAGGTTGCTTTGCAGAAATGG - Intergenic
1061188928 9:129070679-129070701 AGGGGGTTGTTGTGGAGAATTGG + Exonic
1061816941 9:133203172-133203194 GCAGGGTTGCTGTGAGGAACGGG - Intergenic
1062595838 9:137298794-137298816 ACAGGGCGGCAGTGCAGAGTAGG + Intergenic
1062673516 9:137725494-137725516 ACAGGGTTGCTGAGCTGGACAGG + Intronic
1187429831 X:19211826-19211848 AAAGGGCTGCTGTGTCGAATGGG - Intergenic
1188137078 X:26504276-26504298 ACAGGCTTCCTGGACAGAATAGG + Intergenic
1188711300 X:33403463-33403485 TCAGGGATGCTCTTCAGAATCGG - Intergenic
1189455887 X:41189344-41189366 ACAGGTTTGCTGTGAAGCATTGG + Exonic
1190240168 X:48651896-48651918 ATAGGGTTGCTGTGAAAATTAGG + Intergenic
1195239876 X:102940436-102940458 ACAGGCTTGCTTTCCACAATGGG - Intergenic
1199088025 X:143651609-143651631 ATAGGGTTGCTGTGAGGAGTAGG - Intergenic
1200740416 Y:6847683-6847705 ACAGAGCTCCTGTGCAGTATGGG - Intergenic