ID: 1062800329

View in Genome Browser
Species Human (GRCh38)
Location 10:374445-374467
Sequence GTGCTGCACCCATCTCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 168}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062800329_1062800341 12 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800341 10:374480-374502 TGTTTAGCAGACAGGGGCAGGGG No data
1062800329_1062800334 5 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800334 10:374473-374495 CCCTCCCTGTTTAGCAGACAGGG No data
1062800329_1062800342 17 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800342 10:374485-374507 AGCAGACAGGGGCAGGGGCGAGG No data
1062800329_1062800343 20 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800343 10:374488-374510 AGACAGGGGCAGGGGCGAGGAGG No data
1062800329_1062800339 10 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800339 10:374478-374500 CCTGTTTAGCAGACAGGGGCAGG No data
1062800329_1062800336 6 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800336 10:374474-374496 CCTCCCTGTTTAGCAGACAGGGG No data
1062800329_1062800340 11 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800340 10:374479-374501 CTGTTTAGCAGACAGGGGCAGGG No data
1062800329_1062800344 21 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800344 10:374489-374511 GACAGGGGCAGGGGCGAGGAGGG No data
1062800329_1062800332 4 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800332 10:374472-374494 ACCCTCCCTGTTTAGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062800329 Original CRISPR GTGCTGCACCCATCTCCACA GGG (reversed) Intronic
900239288 1:1606975-1606997 CTGCTGTCCGCATCTCCACAGGG + Intergenic
900374842 1:2349005-2349027 CTGCTGCACCCCTCAGCACAGGG + Intronic
900500996 1:3004551-3004573 GTGGTGTCCCCAGCTCCACAGGG - Intergenic
900952778 1:5867328-5867350 CGGCTGCAGCCATCTCCACAGGG + Intronic
900973539 1:6004588-6004610 ATTCTGCCCCCATCGCCACATGG + Intronic
901573161 1:10178372-10178394 GTCCTGCAGCCCTCTCCAGAGGG + Intronic
901631145 1:10648811-10648833 CTGCTGCACCCACGTCCCCAGGG - Intronic
901754730 1:11434662-11434684 CAGCTGCACCCAGCTCCCCAGGG + Intergenic
903345900 1:22684222-22684244 TTGGCCCACCCATCTCCACATGG - Intergenic
904294935 1:29514017-29514039 TTGCTGCTCCCATCTTCATATGG + Intergenic
904581548 1:31547731-31547753 ATGCTCCACCCATCCCCACCGGG - Intergenic
907302728 1:53498664-53498686 GTGCTGCAGCCATCTCCACGGGG - Intergenic
911154183 1:94623022-94623044 GTGCTGCAGGCAGCTCCACCAGG - Intergenic
912686813 1:111774474-111774496 ATGCTGCCCCCAGCTCCACCAGG + Intronic
913403076 1:118457376-118457398 TTGGTGCACCCATCACCAAAAGG - Intergenic
918716732 1:187798284-187798306 AGGCTTCAGCCATCTCCACAGGG + Intergenic
919613088 1:199771034-199771056 GAGCTTCAGCCAACTCCACAGGG + Intergenic
921482666 1:215680700-215680722 GTGCTGCATCCAGCTCAAAATGG + Intronic
922570473 1:226631778-226631800 GTTCTGCACCCCTCTCCCCATGG - Exonic
1062800329 10:374445-374467 GTGCTGCACCCATCTCCACAGGG - Intronic
1063944893 10:11166237-11166259 GTGCTGCTCCCAGCTCCAAAAGG - Intronic
1066640669 10:37551438-37551460 TTGCTGCCCCCATCTCAGCAAGG - Intergenic
1067068102 10:43114863-43114885 GTTCTGCCCCCATTTCCATAGGG + Intronic
1071276304 10:84058827-84058849 GTGCTGCAACCATATCCCTAGGG + Intergenic
1072206613 10:93210526-93210548 ATCCTGCCCCCATCTTCACATGG - Intergenic
1073623135 10:105069771-105069793 GTGCTGCACCTATCAACAGATGG + Intronic
1074728407 10:116339937-116339959 GGGCTGTTCCCATCTCCACAGGG - Intronic
1074875511 10:117610358-117610380 AGGCTGCACCCTTCTCCCCAGGG + Intergenic
1076724475 10:132407076-132407098 GTGGTGCCCCCAGCCCCACAAGG - Intronic
1076904579 10:133355667-133355689 GAGCTGCCCCCATCCCCACCGGG - Intronic
1077086871 11:757260-757282 GCCCTGCACCCATGTCCAGATGG + Intronic
1077369360 11:2174333-2174355 GGGCAGCACTCACCTCCACAGGG - Intergenic
1079322229 11:19460690-19460712 GTGCTGCACCCATTTACATTAGG - Intronic
1081677859 11:44981324-44981346 GTGCTGCACCCAAATCCCCTTGG - Intergenic
1084671404 11:70608677-70608699 CTGCTTCACCCACCTCGACACGG + Intronic
1086812699 11:91330426-91330448 TTTCTGCCCCCATCTTCACATGG + Intergenic
1089207274 11:116774618-116774640 GTGCTGCAACCCCCTCAACATGG - Intergenic
1090247359 11:125225881-125225903 GAGCTAGACCCTTCTCCACAAGG + Intronic
1093228372 12:16513492-16513514 CTGGTGGTCCCATCTCCACATGG - Intronic
1095675427 12:44911872-44911894 GTGCTGCACCCATTAACTCAGGG - Intronic
1100401406 12:94233258-94233280 TTGCTGCTCCCCTCTCCCCAGGG - Intronic
1100655111 12:96635877-96635899 GTGGTGCTCCCAACTCCACAGGG - Intronic
1101517436 12:105449759-105449781 CTGCTGCCTTCATCTCCACATGG + Intergenic
1101937059 12:109066807-109066829 GTGCTACACTCCTCTCCACAGGG - Intronic
1103706756 12:122879004-122879026 ATGCTGCCCCCGTCTTCACATGG - Intronic
1104058428 12:125247816-125247838 GTGCCGCCCCCACCTCCAGATGG + Intronic
1104169414 12:126265574-126265596 GTGCTGTACCCATCAGCAGATGG - Intergenic
1105024274 12:132838171-132838193 GGGCTGCTCCCAGCACCACACGG - Intronic
1105549817 13:21382957-21382979 GTTCTGGATCCATCCCCACAAGG + Exonic
1108378659 13:49836762-49836784 GTGCTGCCCCCACCTCCAACTGG - Intergenic
1109916040 13:68985941-68985963 GTTCTGGACCCATCCCTACAAGG - Intergenic
1110260538 13:73479964-73479986 GAGCAGCAACCATCTTCACAAGG - Intergenic
1116995423 14:51318849-51318871 GTGCTTCAGCCATCTGCTCAGGG - Intergenic
1119265041 14:73259468-73259490 GTGCTGCCCCGATGGCCACACGG + Exonic
1119746977 14:77051601-77051623 GTGCTGAACCCAGCTCAACAGGG - Intergenic
1126098449 15:45105605-45105627 GGGCTGGACCCATCTCCAAAAGG + Intronic
1126463471 15:48938553-48938575 GTGCTGTACCCAACTTCAAAGGG - Intronic
1127682452 15:61310956-61310978 GTGCTGCAGCCAGCTCACCAAGG - Intergenic
1127960899 15:63890006-63890028 TTGCTGCCCCCATCTCAAGAAGG + Intergenic
1129804362 15:78442718-78442740 GTGCAGCACCAATCTCCGCAAGG + Intronic
1129955166 15:79629822-79629844 GTGCTGCTCATATTTCCACAAGG + Intergenic
1131025496 15:89137962-89137984 GGGCTTCACCCTTCTCCACTAGG - Intronic
1132700927 16:1221813-1221835 CTGCTGCACCCATCTGCGGATGG - Exonic
1138974596 16:62188570-62188592 GTGCTGCACCCAACTACCCATGG - Intergenic
1144461280 17:15460613-15460635 GTGCTGCCCCCATATCCGCCTGG + Intronic
1145247974 17:21282327-21282349 GTGATGCAGCCATCTCCATCTGG - Intergenic
1151740284 17:75977328-75977350 GTGATCCACCCTGCTCCACAAGG - Intronic
1154038640 18:10832561-10832583 GTACCCCTCCCATCTCCACAGGG - Intronic
1160174712 18:76583412-76583434 GTGCAGCTCCCATCTCCAGGTGG + Intergenic
1160386196 18:78498326-78498348 TTGCTGCACCCAGCTCCTCTTGG + Intergenic
1163649308 19:18507935-18507957 CAGCTGCTCCCAACTCCACAAGG + Intronic
1164599431 19:29550941-29550963 GAGCTGCAGCCCTCTCCACTGGG - Intronic
1164714757 19:30383453-30383475 GGGGTGCAGCCACCTCCACAGGG - Intronic
1164998961 19:32744963-32744985 GTGATGCACTCACCACCACAAGG - Intronic
1167208048 19:48115772-48115794 TGGCTGCTCCCACCTCCACAAGG + Intronic
925185176 2:1842277-1842299 GTGCTGCCCCCACCTGAACAGGG - Intronic
926799947 2:16651544-16651566 GTGCGGGACCCATGTTCACAAGG - Intronic
930244969 2:48974417-48974439 GTGCTGCTGCCATTTGCACATGG + Intronic
932128601 2:69167615-69167637 GAGCTGCACCCTGCTCCCCAGGG + Intronic
932640094 2:73437169-73437191 GAGCTCCACACATCTCCATAAGG - Intronic
936462779 2:112724568-112724590 GTTCAACACCCACCTCCACAAGG + Intronic
937316117 2:120933088-120933110 GTCCTGCTCCCCTCTCCCCAGGG - Intronic
941912152 2:170774082-170774104 GTGCTGTTCCCATTGCCACAAGG + Intergenic
944630936 2:201623355-201623377 GTGCAGGACCCATCTCAAGAGGG + Exonic
945321426 2:208428418-208428440 CTGCTGCACACCCCTCCACATGG - Intronic
948834790 2:240620666-240620688 GTGATGGCCCCATCCCCACAGGG - Intronic
948867564 2:240783449-240783471 GTGGTGCCCCAATCTCCCCAGGG + Intronic
1171013558 20:21521696-21521718 CCGCTGCACCCACCTCCACCGGG - Intergenic
1171035089 20:21707580-21707602 GGGCTGCAGCCACCTTCACAAGG + Intronic
1173728198 20:45311542-45311564 GTCGTGCATCCATCTCCACTTGG - Intronic
1174055346 20:47794684-47794706 GTGCTGGTCCCATTTCCACCTGG + Intergenic
1174558315 20:51412420-51412442 CTGCTGCCCCCTTCTCCACACGG + Intronic
1175249777 20:57602230-57602252 GTGCTGAAGCCAGCTCCACTGGG - Intergenic
1175626333 20:60491015-60491037 AGGCTGCACTCATCTCCCCAAGG - Intergenic
1175935441 20:62511793-62511815 GTGCTGGCCCCATCAGCACAGGG - Intergenic
1176056141 20:63150370-63150392 GTGCTGGACCCCTCCCCACCAGG + Intergenic
1176124597 20:63469837-63469859 GTGCAGCCCCCACCTCCACTTGG - Intronic
1179280820 21:39932434-39932456 TTCCTGCACCTGTCTCCACATGG - Intergenic
1180716176 22:17873847-17873869 GTGGTGTGGCCATCTCCACATGG - Intronic
1181899186 22:26138739-26138761 GTGCTACACCCACATTCACATGG - Intergenic
1182236241 22:28879013-28879035 GTGCTGCACCCATTAACTCATGG - Intergenic
1183109438 22:35638176-35638198 GCTCTGCCCCCATCTTCACATGG + Intergenic
1183205623 22:36417010-36417032 CTCCTGCACCCAGCTCCACCTGG + Intergenic
1185215644 22:49598637-49598659 CTGCTGCCCCCAGCTCCACAGGG + Intronic
950426842 3:12928812-12928834 GTCCTGCAGCCCTCTCCCCAGGG - Intronic
954301317 3:49702175-49702197 GTGCAGCATCCCTCCCCACAGGG - Intronic
954393212 3:50278351-50278373 CCCCTGCTCCCATCTCCACAAGG - Intergenic
954966032 3:54611947-54611969 GTGCTGTACACATTTGCACAAGG + Intronic
961583975 3:127907049-127907071 TTGCTGCACCCATCTACATTAGG - Intergenic
962197241 3:133374888-133374910 CTGCTCTACCCATCTCCCCAGGG - Intronic
962930006 3:140027380-140027402 GGGCTGCCTCCATCTTCACACGG - Intronic
963897180 3:150699439-150699461 ATGCCCCACCCATCTGCACAGGG + Intronic
964542808 3:157798623-157798645 TTGCTGCACCCATCTACATTAGG + Intergenic
967424356 3:189309271-189309293 GTGCTTATACCATCTCCACATGG + Intronic
969222454 4:5770101-5770123 GTGCTGCCCTCAGCTCCACCAGG - Intronic
969648446 4:8448009-8448031 CTGCTGCTCCCATCTTCCCAGGG + Intronic
969869473 4:10095746-10095768 GTGCTGCACCCTCAGCCACAGGG - Intronic
973725016 4:53766563-53766585 GTGATGCTGCCATCTCAACATGG + Intronic
976515073 4:85955575-85955597 CCTCTGCCCCCATCTCCACATGG + Intronic
977738211 4:100444082-100444104 GTGCTGCACCCCTCCCACCAAGG - Intronic
981672357 4:147301482-147301504 GTGCTGAGCCCATCTAAACATGG + Intergenic
982060408 4:151598964-151598986 GTGCTGCCCCCAGCCCCACTGGG + Intronic
982741320 4:159060272-159060294 GTGCTGCTCCCCTCCCCACTAGG - Intergenic
990672054 5:58142921-58142943 GTGCTGCATCCTTCTCAAAATGG + Intergenic
997442507 5:133918826-133918848 GAGCCAGACCCATCTCCACAGGG + Intergenic
997715831 5:136041963-136041985 GTACTGCACCCGTGTGCACAGGG + Intronic
999854745 5:155581750-155581772 TTGCTGCCTCCATCTTCACATGG - Intergenic
1001398992 5:171435668-171435690 GTTCCTCACCCATCTCCACGTGG + Intronic
1002446725 5:179294653-179294675 GGGCTGCACCCACATCCGCAGGG + Intronic
1003146039 6:3511581-3511603 GTGCTCCACCCAGCTCCCCTTGG + Intergenic
1005654218 6:27916461-27916483 GTGCTGCACCCACACCAACATGG + Intergenic
1005671962 6:28115356-28115378 GTGATCCGCCCATCTCCACCTGG - Intergenic
1007750432 6:44067735-44067757 GTCCAGCCCCAATCTCCACATGG - Intergenic
1008766412 6:54921765-54921787 GTGTTGCACACATGGCCACATGG - Intronic
1010605285 6:77882195-77882217 GTCCTGAACCCATCTTCCCATGG + Intronic
1010958069 6:82114236-82114258 GTGCTGCTTCCATGTCCTCAAGG + Intergenic
1011779465 6:90770811-90770833 GTAGTGCACCCCACTCCACATGG - Intergenic
1013778630 6:113706390-113706412 GTGCTGCACCCATTAACTCAGGG + Intergenic
1017276105 6:152570642-152570664 GTGCTGCACCTATTCCCACCAGG + Intronic
1018899940 6:168045947-168045969 GGGCTGCCCCCATTTCCACCGGG + Intergenic
1019181072 6:170187495-170187517 GTTCTGCACCCTCCTCCAGAAGG - Intergenic
1020567272 7:9813401-9813423 GCCCTGCACCCTTATCCACATGG - Intergenic
1021447037 7:20744665-20744687 GTGCTGCACCCATTAACTCATGG - Intronic
1026362575 7:69616333-69616355 GTACAGCATCTATCTCCACATGG + Intronic
1028172685 7:87617710-87617732 GTTCTCCACCATTCTCCACATGG + Intronic
1032609034 7:133390943-133390965 GTGATGTACCCTTCTTCACAGGG + Intronic
1033016035 7:137672712-137672734 TTCCTGCCCCCATCACCACATGG + Intronic
1034350170 7:150410193-150410215 GTGCAGAACCCATCTGGACACGG + Intronic
1034531074 7:151696860-151696882 CTGCTGCTGCCAGCTCCACAGGG - Intronic
1035459374 7:159029796-159029818 CTGCCCCACCCAACTCCACAGGG - Exonic
1036631703 8:10520461-10520483 CTGCTTCTGCCATCTCCACAAGG - Intergenic
1036987040 8:13544997-13545019 GTACTGCAGCCCTGTCCACAGGG + Intergenic
1037755197 8:21705873-21705895 TTGCTGCCCCCATCTCAGCAGGG - Intronic
1040709461 8:50170873-50170895 GGCATGCAACCATCTCCACAGGG + Intronic
1041727229 8:61029687-61029709 TTGCTGCACCCATCAACCCAAGG + Intergenic
1042527012 8:69773902-69773924 GTGTTCCACACATCTACACATGG + Intronic
1043620355 8:82183318-82183340 GTGCTGAATCAATATCCACACGG + Intergenic
1045286911 8:100799862-100799884 CTGCTGCACCCAGCCCAACAGGG + Intergenic
1046509749 8:115187070-115187092 TTGCTGCACACACCACCACATGG - Intergenic
1049217990 8:141416581-141416603 TGGGTGCACCCAGCTCCACAGGG - Intronic
1049316671 8:141972887-141972909 CTGCAGCTCCCATCGCCACAGGG + Intergenic
1049397670 8:142409112-142409134 GTGCTGCACCCACTCCCGCACGG - Intergenic
1049421413 8:142518232-142518254 GGGCGGCACCCACCTCCACACGG - Exonic
1050496686 9:6250250-6250272 GTGCTGCCCCCATCTCTTCTGGG + Intronic
1052242664 9:26293165-26293187 CTGCTGTGCTCATCTCCACAGGG + Intergenic
1052456673 9:28707847-28707869 GTCCTGCATCTATCACCACATGG + Intergenic
1053454771 9:38225617-38225639 GTGGTGCACCCCTGTCCTCAGGG - Intergenic
1053601208 9:39611326-39611348 GTGGTGCACCCTTATCCACAGGG + Intergenic
1053858857 9:42365125-42365147 GTGGTGCACCCTTATCCACAGGG + Intergenic
1054252329 9:62731112-62731134 GTGGTGCACCCTTATCCACAGGG - Intergenic
1054566443 9:66765611-66765633 GTGGTGCAACCTTATCCACAGGG - Intergenic
1055281666 9:74681342-74681364 GTGCTGCTGCCGCCTCCACATGG + Intronic
1056008602 9:82301961-82301983 GTGCTGTACCCTGCTCCCCAAGG - Intergenic
1057230462 9:93318604-93318626 GAGCTGCACTTGTCTCCACAGGG - Intronic
1058745159 9:107983270-107983292 GGGCTCCACCCAACCCCACATGG + Intergenic
1059247774 9:112863066-112863088 GTTCTACAACCATCTCCACGTGG + Intronic
1059323702 9:113488780-113488802 GTGCTGCTCACAGCTTCACAGGG - Intronic
1061020608 9:128012001-128012023 CTCCAGCACCCATCTCCACATGG + Intergenic
1061221132 9:129252955-129252977 GTGCAGCCACCATGTCCACAGGG - Intergenic
1061378866 9:130242344-130242366 ATCCTTCACCCATTTCCACAGGG + Intergenic
1062686025 9:137813905-137813927 GTGCTGGACCCATCTCTCCGGGG - Intronic
1185819737 X:3190752-3190774 GTGCTGTCCACAACTCCACAAGG + Intergenic
1189538989 X:41966599-41966621 GTGCTGCATTCCTTTCCACAAGG - Intergenic
1191714071 X:64182095-64182117 GTGCAGCACCCATCACCAACAGG - Intergenic
1192560948 X:72127557-72127579 GTCCTTCACACTTCTCCACAGGG + Intronic
1198411139 X:136369801-136369823 GTCCTCCTCCCATCTCCTCAGGG + Intronic
1200088595 X:153623980-153624002 TTTCTGCCTCCATCTCCACACGG - Intergenic
1201259514 Y:12144897-12144919 GTGCTGCCCACAGCTCCACATGG - Intergenic