ID: 1062800330

View in Genome Browser
Species Human (GRCh38)
Location 10:374446-374468
Sequence GGTGCTGCACCCATCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 164}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062800330_1062800342 16 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800342 10:374485-374507 AGCAGACAGGGGCAGGGGCGAGG No data
1062800330_1062800336 5 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800336 10:374474-374496 CCTCCCTGTTTAGCAGACAGGGG No data
1062800330_1062800344 20 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800344 10:374489-374511 GACAGGGGCAGGGGCGAGGAGGG No data
1062800330_1062800343 19 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800343 10:374488-374510 AGACAGGGGCAGGGGCGAGGAGG No data
1062800330_1062800341 11 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800341 10:374480-374502 TGTTTAGCAGACAGGGGCAGGGG No data
1062800330_1062800340 10 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800340 10:374479-374501 CTGTTTAGCAGACAGGGGCAGGG No data
1062800330_1062800339 9 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800339 10:374478-374500 CCTGTTTAGCAGACAGGGGCAGG No data
1062800330_1062800334 4 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800334 10:374473-374495 CCCTCCCTGTTTAGCAGACAGGG No data
1062800330_1062800332 3 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800332 10:374472-374494 ACCCTCCCTGTTTAGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062800330 Original CRISPR GGTGCTGCACCCATCTCCAC AGG (reversed) Intronic
900200242 1:1401488-1401510 GGTGATGCACACTTCTCCCCTGG - Intronic
900450068 1:2701525-2701547 GGAGCTGCACCCATACCCCCAGG + Intronic
900453555 1:2762636-2762658 GGAGCTGCACCCATACCCCCAGG + Intronic
900454268 1:2766221-2766243 GGAGCTGCACCCATACCCCCAGG + Intronic
900454997 1:2769897-2769919 GGAGCTGCACCCATACCCCCAGG + Intronic
900455747 1:2773643-2773665 GGAGCTGCACCCATACCCCCAGG + Intronic
900952777 1:5867327-5867349 TCGGCTGCAGCCATCTCCACAGG + Intronic
901631146 1:10648812-10648834 GCTGCTGCACCCACGTCCCCAGG - Intronic
902383885 1:16065484-16065506 GGTGCTGCCCCCAATTCCCCTGG + Intronic
903066442 1:20702347-20702369 GGGGCTGCCTCCATCACCACTGG + Intronic
904581549 1:31547732-31547754 CATGCTCCACCCATCCCCACCGG - Intergenic
904597137 1:31653986-31654008 GGAGCTGCCGCCATCTCCATGGG + Exonic
905004734 1:34700449-34700471 GGTGATGAACCCATCTCTGCAGG + Intergenic
907302729 1:53498665-53498687 TGTGCTGCAGCCATCTCCACGGG - Intergenic
907989729 1:59568083-59568105 GGTGCTGCTCCAAACTTCACTGG - Intronic
908786073 1:67735991-67736013 GGTGCTGACCCCCTCTGCACTGG + Intronic
914193430 1:145430984-145431006 GCTGCTTCACACATCTCAACCGG - Intergenic
915471294 1:156127094-156127116 GGTGGTGCAGCCCACTCCACTGG - Intronic
915953982 1:160208116-160208138 GGTGCTGCCACCTCCTCCACAGG + Intronic
918232795 1:182551039-182551061 GGTGCTCCAGCCCCCTCCACTGG + Intronic
918716731 1:187798283-187798305 GAGGCTTCAGCCATCTCCACAGG + Intergenic
920725195 1:208428433-208428455 GGAGGGGCCCCCATCTCCACTGG - Intergenic
920799703 1:209174487-209174509 GGGACTGCAGCCATCTCCAGGGG - Intergenic
923565531 1:235073478-235073500 GGAGCTGCACCAATTTCCACAGG + Intergenic
1062800330 10:374446-374468 GGTGCTGCACCCATCTCCACAGG - Intronic
1063092418 10:2879004-2879026 GGTGCTGCCCCGAGCTGCACCGG + Intergenic
1063381273 10:5587717-5587739 GGGGCTGCAGCCATGTCCTCGGG + Intergenic
1063454450 10:6173398-6173420 GGTGCTGTAACCATATGCACAGG - Intronic
1063550385 10:7027105-7027127 GGTGCTGCACCCAAGTGCAGAGG - Intergenic
1070826360 10:79392485-79392507 GATGCTTCACCCATCGGCACAGG - Intronic
1071178156 10:82951666-82951688 GTTGCTAGACCCATTTCCACAGG - Intronic
1071276303 10:84058826-84058848 GGTGCTGCAACCATATCCCTAGG + Intergenic
1074057025 10:109931841-109931863 GGTTTTACAACCATCTCCACAGG + Intergenic
1074728408 10:116339938-116339960 GGGGCTGTTCCCATCTCCACAGG - Intronic
1074829023 10:117235711-117235733 TGCGTTGCACACATCTCCACAGG - Intergenic
1074875510 10:117610357-117610379 GAGGCTGCACCCTTCTCCCCAGG + Intergenic
1076283573 10:129272194-129272216 GGGGCTGCAGCCATCCCCAGTGG - Intergenic
1076621288 10:131789782-131789804 GATGCTGCATCCACCTCCTCTGG + Intergenic
1076904580 10:133355668-133355690 GGAGCTGCCCCCATCCCCACCGG - Intronic
1077066018 11:641213-641235 GGGGCCCCACCCATCACCACAGG - Intergenic
1077341297 11:2027572-2027594 GGGGCTGCACCCTTGCCCACTGG + Intergenic
1077899932 11:6479971-6479993 GGTGATGGACTCATCCCCACAGG - Exonic
1077955929 11:7020103-7020125 CGTGATGTACCCATCTACACGGG + Exonic
1083613162 11:64014021-64014043 GGTGGTGCTCTCATCTGCACTGG + Intronic
1083628050 11:64082097-64082119 GGGGCTGTGCCCATCTCCCCAGG + Intronic
1084888112 11:72223818-72223840 GGTGCTGCCCCCGGCTCCCCGGG + Intronic
1202824282 11_KI270721v1_random:82761-82783 GGGGCTGCACCCTTGCCCACTGG + Intergenic
1093236288 12:16611392-16611414 GGTGTTTCACCCAGCTCCTCTGG + Intergenic
1096152594 12:49323838-49323860 GTTTCTGCACCCATCTCTAGGGG - Exonic
1100655112 12:96635878-96635900 GGTGGTGCTCCCAACTCCACAGG - Intronic
1101937060 12:109066808-109066830 GGTGCTACACTCCTCTCCACAGG - Intronic
1102226140 12:111229565-111229587 GGTTCTTCACCCATCCCCCCAGG - Intronic
1102289604 12:111688370-111688392 GGTCCTGCACCCATCTGCTGAGG - Intronic
1104906083 12:132214184-132214206 GGTTCTCCAGCCATCTCCAAAGG - Intronic
1106588957 13:31081953-31081975 GGTGCTGCCACCAAGTCCACTGG + Intergenic
1113535230 13:111061286-111061308 GGTGCAGCATGCATGTCCACTGG + Intergenic
1118554171 14:66995844-66995866 GGTACTGCACTGATCTTCACTGG - Intronic
1119266700 14:73266955-73266977 GGTGCTGCAGCCCTCTCCCCTGG - Intronic
1119746978 14:77051602-77051624 TGTGCTGAACCCAGCTCAACAGG - Intergenic
1121443985 14:93967179-93967201 GGGGCTCCACCCAGCTGCACAGG - Intronic
1124472853 15:30003556-30003578 GGTGCAGCCTCCATCTCCACTGG - Intergenic
1124890153 15:33725295-33725317 GGTGCCGCCTCCATCTCCAAGGG - Intronic
1125831409 15:42719366-42719388 GGTGCTTCTCCCATCACCACAGG + Intronic
1126297251 15:47154142-47154164 GCTTCTGCACCCATGTGCACTGG + Intergenic
1126463472 15:48938554-48938576 GGTGCTGTACCCAACTTCAAAGG - Intronic
1128584357 15:68834813-68834835 GGTGCTCCTCCCACCTCCTCTGG + Intronic
1128634765 15:69296042-69296064 TGTTCTTCACCCATCCCCACTGG - Intergenic
1130566711 15:85002439-85002461 GGTGGCGCACCCAACTCTACAGG - Intronic
1132037824 15:98501410-98501432 GGTGTTACACCCATCCCCATGGG - Intronic
1132801373 16:1756034-1756056 GGGGCTGCACCCATCACCCCTGG - Intronic
1134384653 16:13760341-13760363 GGTACTCCACCCACCTCCCCTGG - Intergenic
1135942121 16:26831016-26831038 GGTGCTCCACCCATCACCCCAGG + Intergenic
1136574291 16:31114154-31114176 GGTGCTCCACCCAGATCCTCTGG - Intergenic
1137817145 16:51409277-51409299 GGTGCTGCAGAGGTCTCCACTGG - Intergenic
1141613281 16:85195998-85196020 GGTGCTGCCCCCGACTCCGCTGG - Intergenic
1141673751 16:85506669-85506691 GGCGCTGCCCCCACCTCCCCAGG - Intergenic
1143344531 17:6240138-6240160 GGCTCTGCCCCCACCTCCACTGG + Intergenic
1146272818 17:31495497-31495519 GGTGGTGCACCCAGCTACTCAGG - Intronic
1147988913 17:44321666-44321688 GGTCCTGCACCACTCTCCTCTGG - Intronic
1150452188 17:65278460-65278482 GGGACTGCACCCATCACAACTGG - Intergenic
1152880481 17:82811968-82811990 GGAACTGCACCCATCCCCAGGGG + Intronic
1160569100 18:79804364-79804386 GGTGCTGCACCAGGCTCCAGGGG + Intergenic
1160814727 19:1029643-1029665 TGCTCTGCACCCATCTCCCCAGG - Intronic
1161434428 19:4254173-4254195 AGTGCTCCTCCCATCTCCATGGG - Intronic
1161572763 19:5039591-5039613 GGTGCTGTACCCAGCTTCCCAGG + Intronic
1164599432 19:29550942-29550964 AGAGCTGCAGCCCTCTCCACTGG - Intronic
1164612125 19:29639597-29639619 GGTGGTGCTCCCAACTCCACGGG - Intergenic
1164698339 19:30263365-30263387 GGTTCTGCTGCCAGCTCCACGGG - Intronic
1166299163 19:41904440-41904462 GGTTCTGCTCCCCACTCCACAGG - Intronic
925185177 2:1842278-1842300 GGTGCTGCCCCCACCTGAACAGG - Intronic
925699447 2:6619187-6619209 GTTTCTGCAGCCATCGCCACTGG + Intergenic
926133871 2:10323099-10323121 TGTGCTGCAGCCACCACCACTGG + Intronic
926276025 2:11403859-11403881 TGCTCTGCACCCTTCTCCACTGG + Intergenic
926325777 2:11784416-11784438 GGTGCTGCGCCCCTGTCCAGAGG - Intronic
927944781 2:27129125-27129147 GGGGCTGCACCCATCCTTACTGG - Exonic
929984994 2:46720782-46720804 TGTCCTGCACCCAGCTGCACTGG - Intronic
930438593 2:51377960-51377982 TGTGATGCAACTATCTCCACTGG - Intergenic
930890057 2:56374226-56374248 GGTCCTGCACCCAGCCTCACTGG - Intronic
932180541 2:69642960-69642982 GGTGCTGCCCCCTCCTCCGCTGG + Exonic
937316118 2:120933089-120933111 GGTCCTGCTCCCCTCTCCCCAGG - Intronic
938743064 2:134251219-134251241 GGTGCTGCACCTAGCTCCAAGGG - Intronic
943843346 2:192607037-192607059 AGTGCTGCATGCATCTCAACTGG - Intergenic
948867563 2:240783448-240783470 GGTGGTGCCCCAATCTCCCCAGG + Intronic
1170302355 20:14898644-14898666 GGTACTGGTCCCAACTCCACTGG + Intronic
1170851110 20:20005267-20005289 GGTTCTGAGCCCCTCTCCACAGG - Intergenic
1171013560 20:21521697-21521719 GCCGCTGCACCCACCTCCACCGG - Intergenic
1172442954 20:34978631-34978653 GGTGCTGGCCCCACCTCCCCAGG - Intronic
1174077092 20:47945307-47945329 GGAGCTGCATCCAGGTCCACAGG + Intergenic
1175249778 20:57602231-57602253 AGTGCTGAAGCCAGCTCCACTGG - Intergenic
1175585753 20:60138452-60138474 GGTGCTGCCTCCCTATCCACTGG + Intergenic
1175705754 20:61175299-61175321 GGTGGAGCACCCATTTCCAGGGG - Intergenic
1175928915 20:62484468-62484490 GCTGCTGCCCCCAACACCACAGG + Intergenic
1180724797 22:17938829-17938851 GGTGAAGCACACATCTACACAGG + Intronic
1181168761 22:20996815-20996837 GGAGCTGCAGCCATGTGCACGGG - Intronic
1182265587 22:29112416-29112438 GGTACTGCACACACCTCCATGGG - Intronic
1183336338 22:37249253-37249275 AGTGCTACGCCCATCTCCAGGGG + Intergenic
1184124749 22:42479234-42479256 GGTGGCCCACCCAACTCCACGGG + Intergenic
1185215643 22:49598636-49598658 TCTGCTGCCCCCAGCTCCACAGG + Intronic
950632688 3:14293494-14293516 AGTGCTGCGCCCTGCTCCACTGG + Intergenic
953923542 3:46968379-46968401 GGTCCTGCAGCCTTCTCCGCTGG - Intronic
954850243 3:53593868-53593890 GGGACTGCAGCCATCTCCGCTGG - Intronic
958457550 3:94350418-94350440 GATACTGCCTCCATCTCCACTGG + Intergenic
959078887 3:101779463-101779485 GGGGCTGCACCTATCAGCACGGG - Intronic
960926548 3:122800179-122800201 GAAGCTCCACCCTTCTCCACAGG - Intronic
961646824 3:128397199-128397221 GGGGCTGCAGCCATCTCCTGTGG - Intronic
969351038 4:6598069-6598091 GGGACTGCCCCCTTCTCCACTGG + Intronic
969471825 4:7393634-7393656 GGTGCTGCCCCCATGCCCCCAGG - Intronic
969573182 4:8022082-8022104 TGTGCTGGACCCATCCCCACTGG + Intronic
969648445 4:8448008-8448030 GCTGCTGCTCCCATCTTCCCAGG + Intronic
970192655 4:13530362-13530384 GCTGCTGCCCCGGTCTCCACTGG + Intergenic
972318358 4:37948690-37948712 GGTTGTGCAACCATCACCACAGG + Intronic
979174981 4:117651907-117651929 GGAGCTCCACCCAGCTGCACTGG + Intergenic
982060407 4:151598963-151598985 GGTGCTGCCCCCAGCCCCACTGG + Intronic
985543220 5:496329-496351 GGAGCCGCACCCATCCCCACCGG + Intronic
989288358 5:39730780-39730802 GATGCTGCATCCATCTTCATAGG + Intergenic
990855577 5:60263121-60263143 TGTGCTGCACCAACCTCCAATGG + Intronic
992935816 5:81703463-81703485 TGTGCTGCACCCATTCCCTCTGG - Intronic
995561786 5:113389703-113389725 GGTGCTGCACACATCTCAAAGGG - Intronic
997442506 5:133918825-133918847 GGAGCCAGACCCATCTCCACAGG + Intergenic
1002380875 5:178828827-178828849 GGTTCTGCAGCCAACTTCACAGG + Intergenic
1003321707 6:5057884-5057906 GGTGGTGCACCCAGCTACTCAGG - Intergenic
1004699657 6:18067010-18067032 GGTGGCGCATCCCTCTCCACGGG + Intergenic
1007347449 6:41242960-41242982 TGTGCTGCTTCCATCTCCAGTGG - Intergenic
1015873618 6:137801142-137801164 GGAGATGCACTCATCACCACTGG - Intergenic
1018462352 6:164010465-164010487 GAGGCTGGACCCATCTTCACTGG - Intergenic
1018899939 6:168045946-168045968 GGGGCTGCCCCCATTTCCACCGG + Intergenic
1019051817 6:169189413-169189435 GGTGCTGCACTCATCACCGAGGG + Intergenic
1019308940 7:349570-349592 GGTGCGGCGCCCACCTCCTCCGG + Intergenic
1020035430 7:4960403-4960425 GGTGCTGGGCCCAGCTACACTGG - Intergenic
1023029122 7:36077777-36077799 GGTGCTGCCCCCGACTCTACTGG - Intergenic
1028412179 7:90541876-90541898 GGTGAAGCACTCATATCCACTGG - Intronic
1029606409 7:101601844-101601866 GGTCCTGGTCCCATGTCCACGGG - Intergenic
1032609033 7:133390942-133390964 GGTGATGTACCCTTCTTCACAGG + Intronic
1033332915 7:140430747-140430769 GGTACGGCAGCCATATCCACAGG + Intergenic
1034531075 7:151696861-151696883 GCTGCTGCTGCCAGCTCCACAGG - Intronic
1036296637 8:7543085-7543107 GAAGCTGCACCCACCTCCAGGGG - Intergenic
1036325929 8:7777934-7777956 GAAGCTGCACCCACCTCCAGGGG + Intergenic
1036760724 8:11506965-11506987 GGTTCTGCACCCATTGTCACAGG - Intronic
1039814050 8:41076429-41076451 GGAGCTTCACACATCTCCACAGG - Intergenic
1040709460 8:50170872-50170894 GGGCATGCAACCATCTCCACAGG + Intronic
1043460708 8:80457232-80457254 GGTGCTGCAGCCAGCTTGACTGG + Intergenic
1045286910 8:100799861-100799883 GCTGCTGCACCCAGCCCAACAGG + Intergenic
1047311804 8:123698328-123698350 GGGGCTGCAACCATCTCTATTGG + Intronic
1048753323 8:137704175-137704197 GGTGGTGCCCCCAGCTCCACAGG + Intergenic
1049217991 8:141416582-141416604 GTGGGTGCACCCAGCTCCACAGG - Intronic
1049255608 8:141612110-141612132 GGTGCTGCCCCAGGCTCCACGGG + Intergenic
1049316670 8:141972886-141972908 GCTGCAGCTCCCATCGCCACAGG + Intergenic
1049745420 8:144261195-144261217 GCTGCTGCACCCCTGTTCACCGG + Exonic
1050496685 9:6250249-6250271 GGTGCTGCCCCCATCTCTTCTGG + Intronic
1053344651 9:37369646-37369668 CGTTCTGCTCCAATCTCCACAGG - Intergenic
1053601207 9:39611325-39611347 AGTGGTGCACCCTTATCCACAGG + Intergenic
1053858856 9:42365124-42365146 AGTGGTGCACCCTTATCCACAGG + Intergenic
1054160218 9:61668014-61668036 GCTGCTTCCCCCATCTCCGCTGG - Intergenic
1054252330 9:62731113-62731135 AGTGGTGCACCCTTATCCACAGG - Intergenic
1056901665 9:90605841-90605863 GCTGCTGCAGCCACATCCACAGG - Intergenic
1057230463 9:93318605-93318627 GGAGCTGCACTTGTCTCCACAGG - Intronic
1057436598 9:95045821-95045843 GGTACTGCTCCCCTCTCAACTGG - Intronic
1061204821 9:129156772-129156794 GCTCCTGCACCCATCTCTCCAGG + Intergenic
1061221133 9:129252956-129252978 GGTGCAGCCACCATGTCCACAGG - Intergenic
1061288472 9:129637609-129637631 AGAGCTGCACCCTTCACCACTGG + Exonic
1061790628 9:133057150-133057172 GCTGCTGCACCCAGCCCCTCTGG - Intronic
1061870235 9:133516488-133516510 GGTGCTGCCCCCACCCCCAGGGG - Intronic
1062335423 9:136063314-136063336 GGCCCTGCAGGCATCTCCACAGG - Intronic
1062686026 9:137813906-137813928 TGTGCTGGACCCATCTCTCCGGG - Intronic
1191728538 X:64308055-64308077 TGTGCTGCACCCATCAACATAGG - Intronic
1193715082 X:84927733-84927755 GGTGCTGCAGCCACCACCACTGG - Intergenic
1197092816 X:122558852-122558874 GGTGCAGCAGCCACCTCCAGAGG + Intergenic
1199724909 X:150569966-150569988 GGTGCTGCAGGCAGCACCACTGG - Intronic