ID: 1062800339

View in Genome Browser
Species Human (GRCh38)
Location 10:374478-374500
Sequence CCTGTTTAGCAGACAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062800330_1062800339 9 Left 1062800330 10:374446-374468 CCTGTGGAGATGGGTGCAGCACC 0: 1
1: 0
2: 1
3: 22
4: 164
Right 1062800339 10:374478-374500 CCTGTTTAGCAGACAGGGGCAGG No data
1062800329_1062800339 10 Left 1062800329 10:374445-374467 CCCTGTGGAGATGGGTGCAGCAC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1062800339 10:374478-374500 CCTGTTTAGCAGACAGGGGCAGG No data
1062800325_1062800339 27 Left 1062800325 10:374428-374450 CCTATTCTGCACAGCAACCCTGT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1062800339 10:374478-374500 CCTGTTTAGCAGACAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062800339 Original CRISPR CCTGTTTAGCAGACAGGGGC AGG Intronic
No off target data available for this crispr