ID: 1062801087

View in Genome Browser
Species Human (GRCh38)
Location 10:380952-380974
Sequence AGGGAAACTTCCCTCTGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062801087_1062801094 24 Left 1062801087 10:380952-380974 CCCGCACAGAGGGAAGTTTCCCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1062801094 10:380999-381021 TGCAGAGAGGGATGTGTTGGTGG No data
1062801087_1062801092 12 Left 1062801087 10:380952-380974 CCCGCACAGAGGGAAGTTTCCCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1062801092 10:380987-381009 TTCAGAAAACAATGCAGAGAGGG No data
1062801087_1062801093 21 Left 1062801087 10:380952-380974 CCCGCACAGAGGGAAGTTTCCCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1062801093 10:380996-381018 CAATGCAGAGAGGGATGTGTTGG No data
1062801087_1062801091 11 Left 1062801087 10:380952-380974 CCCGCACAGAGGGAAGTTTCCCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1062801091 10:380986-381008 ATTCAGAAAACAATGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062801087 Original CRISPR AGGGAAACTTCCCTCTGTGC GGG (reversed) Intronic
901400952 1:9014887-9014909 AGGGAGACGGCCCTCTGAGCGGG - Intronic
901807808 1:11749104-11749126 AGGGAAAGTGCCCCCTGTTCAGG - Intronic
903182093 1:21609926-21609948 AGGGAAACTGTCCTCTCTGAGGG + Intronic
903655769 1:24948037-24948059 TGGGAAACCTCCTTCTGAGCTGG + Intronic
906125529 1:43424913-43424935 AGGGACACTCACCTCTGAGCTGG + Intronic
908289925 1:62655337-62655359 ACTGAAACCTGCCTCTGTGCAGG + Intronic
909377282 1:74953749-74953771 AGGGAAACCACATTCTGTGCTGG - Intergenic
910713213 1:90203226-90203248 AGGGTTAGTGCCCTCTGTGCTGG - Intergenic
912500278 1:110117107-110117129 TGGGAATCTTCCTTCTGTGCTGG + Intergenic
913025398 1:114833162-114833184 AGGCAAACTTGCCCCTGTGGTGG + Intergenic
914248074 1:145900604-145900626 AGAGAAACTTGCCTGTGTTCAGG + Intronic
915286381 1:154856006-154856028 AGGGGAGCTTCCCTCAGGGCGGG - Intronic
916215012 1:162386592-162386614 AGATACACTTCCCTCTGTGCAGG - Intronic
917646107 1:177030040-177030062 AGGGAAATTTCCCTCATTACAGG + Intronic
922904710 1:229165136-229165158 AGGGAAACTCCCATCAGAGCAGG + Intergenic
1062801087 10:380952-380974 AGGGAAACTTCCCTCTGTGCGGG - Intronic
1064343281 10:14506629-14506651 TGGGAATCTTCCCTTTGTCCAGG + Intergenic
1066268652 10:33800539-33800561 AGGGGAAATTTCCTCTTTGCAGG + Intergenic
1074595337 10:114859433-114859455 AGTGAAACATTCCGCTGTGCTGG + Intronic
1074758325 10:116644693-116644715 AGAGAAAGTCCCCTCTGTGCTGG + Intronic
1081773445 11:45663434-45663456 AGTCAAGCTTCCCTCTGTCCTGG - Intronic
1084323237 11:68385050-68385072 AAGGAAAGTTCCCTCTGCTCTGG - Intronic
1084638778 11:70411857-70411879 AGGGAGACTCCCCTCCGGGCTGG + Intronic
1092563120 12:9637268-9637290 AAGGAAACTTACTTTTGTGCAGG + Intergenic
1097522321 12:60685114-60685136 AGGCAAACTTGCTTCTGCGCCGG + Intergenic
1097588401 12:61542883-61542905 AGGTATTCTTGCCTCTGTGCTGG + Intergenic
1098361796 12:69661642-69661664 AGGCAACCCTCCCTCTGAGCTGG + Intronic
1098525714 12:71484523-71484545 AGGAATACTTCCCTCTGAGTGGG + Intronic
1099938546 12:89157636-89157658 AGGGAACCTGCCCTGTGTCCTGG + Intergenic
1102643130 12:114383877-114383899 AGGCAAAGTTCCTGCTGTGCAGG - Intronic
1103931221 12:124452087-124452109 GGGGAAACTGCCCTCTGTTCAGG - Intronic
1106023026 13:25932429-25932451 AGGAAAATTTCCCTCTGGGGTGG + Intronic
1106553860 13:30793733-30793755 AGTCAAACTGCCCTCTCTGCTGG - Intergenic
1107981883 13:45741853-45741875 AGAGAAACATGCCTCAGTGCTGG + Intergenic
1110940580 13:81343622-81343644 AGGGAATCTTTGCTATGTGCTGG + Intergenic
1111572463 13:90105371-90105393 AGAGAAACTCCCCACTGTGGAGG - Intergenic
1119444949 14:74655288-74655310 AGAGTAACTTCCCTCTCTGTAGG + Intronic
1119725714 14:76920746-76920768 AGGGGAACTGCCATCTGGGCAGG + Intergenic
1121618954 14:95332832-95332854 AGGGAAACTGTTCTCTGTGTGGG + Intergenic
1122738367 14:103856588-103856610 AGGGAAAGCTCGCTGTGTGCAGG - Intergenic
1124394725 15:29291148-29291170 AGGGCAGCTTTCCTCTGTGTGGG - Intronic
1129288208 15:74542043-74542065 AGGGACACCTCCCCCTCTGCTGG + Intronic
1129357003 15:74997925-74997947 GGGGAAACTTCCATCTTAGCAGG + Intronic
1131323789 15:91422886-91422908 ATGGAGGCTTCCCTCTGTTCAGG - Intergenic
1131877236 15:96821855-96821877 AAGGAAATTTCCTTTTGTGCTGG + Intergenic
1132099739 15:99014972-99014994 AGGGAAACTTTCCCCGGAGCCGG + Intergenic
1132881907 16:2166011-2166033 AGGGACACTTCCCGGTGAGCTGG + Intronic
1136292215 16:29281909-29281931 AGGGAAGGTTACCTCTGGGCTGG + Intergenic
1138659650 16:58509629-58509651 AGGGACTCTTCCTTCCGTGCTGG + Intronic
1140901145 16:79369244-79369266 TGGGAGCCTTCCCTATGTGCTGG + Intergenic
1141033588 16:80610000-80610022 AGTTAACCTTGCCTCTGTGCTGG - Intronic
1142098107 16:88255862-88255884 AGGGAAGGTTACCTCTGGGCTGG + Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1144794993 17:17885155-17885177 AGGGTGCCTGCCCTCTGTGCGGG + Intronic
1145926180 17:28648693-28648715 AGGGAAACATCCCTCTTAGCTGG - Exonic
1147125022 17:38361311-38361333 AGGGAAACTTTGCTCTGAGCTGG + Intronic
1150041651 17:61868080-61868102 AGGGGAACTATGCTCTGTGCTGG + Intronic
1151134220 17:71929995-71930017 AGGGAAAAGTCTCTCTGTGTGGG - Intergenic
1151237587 17:72732616-72732638 AGGGAAACATGCCGCTGCGCAGG - Intronic
1152363457 17:79842752-79842774 AGGGAATCTTCTCGCTGAGCGGG + Intergenic
1152537882 17:80960923-80960945 TGGGAATCCTCGCTCTGTGCTGG - Intronic
1155167157 18:23240564-23240586 AGGGAATCTGCCCTCTGTCTGGG - Intronic
1156455036 18:37288257-37288279 AGGGAGACATCCCTCCGCGCAGG - Intronic
1160103781 18:75949234-75949256 AGGGAGAAATCCCTCTGTGGGGG - Intergenic
1160506154 18:79427791-79427813 TGGACAACTGCCCTCTGTGCAGG + Intronic
1166594200 19:44030704-44030726 AGGGGAACTTACCTGAGTGCTGG + Intronic
1166730061 19:45054122-45054144 AGGGAAACTTCTCGCTGCTCTGG + Intronic
925014951 2:516020-516042 AAGGAAAAGACCCTCTGTGCTGG + Intergenic
926230815 2:11002611-11002633 CAGGAGTCTTCCCTCTGTGCTGG - Intergenic
927470484 2:23372166-23372188 AGGCACAATTCTCTCTGTGCTGG - Intergenic
928585026 2:32751016-32751038 AAGCATACTTCTCTCTGTGCTGG + Intronic
930101625 2:47607924-47607946 AGGGAAAATTACCACTGGGCAGG - Intergenic
932055930 2:68444275-68444297 AGGGAAATTTCAATCTGAGCTGG + Intergenic
932086651 2:68768583-68768605 AGAAATGCTTCCCTCTGTGCTGG + Intronic
935079366 2:99777292-99777314 ATGGAAGGTTTCCTCTGTGCAGG - Intronic
935593996 2:104865716-104865738 AGGGAAACTTCCAGGTGTGAGGG + Intergenic
935931362 2:108129845-108129867 ATGGAAACTCCACTCTGTGTGGG - Intergenic
935950556 2:108324774-108324796 GGGGAAACTTGCCTCTAGGCAGG - Intergenic
936327591 2:111519112-111519134 AGGGAAGCTGCCCTCTAGGCAGG + Intergenic
936624377 2:114132715-114132737 AGGGAAACTGCCCTGTTTTCAGG + Intergenic
936808987 2:116372962-116372984 AGAGAAACTGATCTCTGTGCAGG - Intergenic
940673431 2:156698754-156698776 TGGGAAACTTCTCTCTAAGCAGG - Intergenic
941389525 2:164894602-164894624 AGGTAACCTTCCCTGAGTGCTGG + Intergenic
942366167 2:175230085-175230107 AGGAAAATTTCCCTCTGTTAAGG + Intergenic
946583399 2:221156041-221156063 AAGGAAACTTACAACTGTGCTGG + Intergenic
947027678 2:225756440-225756462 AAGGAATCTTCCCTCAGTGTGGG - Intergenic
1170091444 20:12593444-12593466 TGGGAAATTTGCCTCTTTGCTGG + Intergenic
1170370639 20:15644306-15644328 AGAGAATCATCCCTCTCTGCAGG + Intronic
1170809868 20:19665687-19665709 GGGTAAACTTCCCTCTGTACTGG - Intronic
1174483853 20:50849305-50849327 AGGGCAGCATCGCTCTGTGCAGG - Intronic
1176056298 20:63150966-63150988 AGGGAAACTTTCCCCTGCTCTGG - Intergenic
1177955256 21:27590471-27590493 AGGAAAACTTCGTTCTGTTCCGG + Intergenic
1180180236 21:46115654-46115676 TGGGAAGCTTCCCTCAGAGCTGG + Intronic
1181266048 22:21631590-21631612 AGGGTGACTTGCCTCTGTTCTGG + Intergenic
1183508817 22:38223385-38223407 AGGGACACTGCCCTCAATGCTGG + Intronic
1184471454 22:44698469-44698491 AGGGAAATGTCCCTCTGTTAAGG - Intronic
1184897816 22:47422179-47422201 AGGGAAACTTCCATGTTTCCTGG - Intergenic
1185127308 22:49018237-49018259 AGGGAACGTTCACTCTGTCCTGG + Intergenic
950556206 3:13697585-13697607 TGGGAAACCTCCCTGTGAGCTGG - Intergenic
952406568 3:33010203-33010225 AGGGAATCTTCCCACATTGCTGG - Intronic
956166223 3:66400239-66400261 AGGGAAGCTTGTCTCTCTGCAGG + Intronic
960241613 3:115348875-115348897 ATGGAAACCTACCTCTGTGAGGG - Intergenic
963280377 3:143378687-143378709 AGGGAAACTTCCTGTTGTGTGGG + Intronic
964400445 3:156292135-156292157 ACGTAAGATTCCCTCTGTGCGGG + Intronic
966054473 3:175667064-175667086 AGTGAAACTTAAATCTGTGCTGG + Intronic
969755687 4:9148802-9148824 AAGGACACTGCCCTCTGTGGTGG - Intergenic
971039083 4:22730978-22731000 AGGGAAAATTTGCTCTGAGCTGG + Intergenic
971927644 4:33034153-33034175 GGGCAACCTTCCCACTGTGCGGG - Intergenic
974853296 4:67429330-67429352 AGGCAAACTTCCCTTTGTTCTGG - Intergenic
975652890 4:76612102-76612124 AGGCAGAATTCCCTCTGAGCGGG - Intronic
977142149 4:93387016-93387038 AGGGAAGCTTTCCTCTGTGAAGG + Intronic
977845262 4:101760049-101760071 TGCCAAACTTCCCACTGTGCTGG + Intronic
980776808 4:137447291-137447313 AGGGAAAGTTCCTTCAGTGTAGG + Intergenic
982361976 4:154528640-154528662 AGAAAAACCTGCCTCTGTGCTGG + Intergenic
985675417 5:1229028-1229050 GGGGAAAGTGCCCTCCGTGCTGG + Intronic
986326989 5:6683391-6683413 AGGCAAGCTTACCGCTGTGCAGG - Intergenic
993187039 5:84635019-84635041 AGAGAAGCTACCCTCTCTGCTGG - Intergenic
994010673 5:94898581-94898603 AGTGAAACCTCCCTTTGTTCAGG - Intronic
996396656 5:123020791-123020813 TGGGCCACTTCCTTCTGTGCTGG + Intronic
997829780 5:137139994-137140016 GGGGATACTTCCCCCTGGGCTGG + Intronic
998012828 5:138709049-138709071 ATGGAAACTTCTCTCTGTCTGGG - Intronic
998059219 5:139105879-139105901 AAGGCAATTTCTCTCTGTGCAGG + Intronic
998618822 5:143771910-143771932 AGGGAAACATTCCCCTATGCAGG - Intergenic
998652991 5:144142185-144142207 AGTGAAACTCCACTCTGTCCTGG - Intergenic
1001374195 5:171239321-171239343 AGGGAACCTTTACCCTGTGCTGG + Intronic
1001778989 5:174351354-174351376 AGGGGCTCTTCCCTCTTTGCTGG - Intergenic
1002318783 5:178362770-178362792 TGGGATGCTTTCCTCTGTGCCGG - Intronic
1006219850 6:32479479-32479501 GGGCAAACTCTCCTCTGTGCTGG - Intergenic
1006229130 6:32567226-32567248 GGGCAAACTCTCCTCTGTGCTGG - Intronic
1007239315 6:40413754-40413776 AGGAGAACTTCCGTCAGTGCTGG - Intronic
1011795596 6:90948182-90948204 AGAGCAACTACCCTCTCTGCTGG + Intergenic
1011851044 6:91629164-91629186 AAGGAAACTTCCCTCTGTGAAGG - Intergenic
1012143774 6:95656023-95656045 AGGGCAAATTCCCTCTCTTCTGG + Intergenic
1012866327 6:104622628-104622650 AGGGAAACTTCCCCCTAACCAGG + Intergenic
1015262816 6:131257749-131257771 AGGCTTACTTTCCTCTGTGCTGG - Intronic
1015881055 6:137870153-137870175 AGGCAGACTTGCCTCTGTGTTGG + Intronic
1016957380 6:149639682-149639704 AGGAAAACTGCCATCTGAGCTGG - Intronic
1018082382 6:160269764-160269786 AGGGAACCTTCCCTCCCTCCAGG - Intronic
1018574536 6:165245437-165245459 TGGCAAACTTCACTGTGTGCTGG - Intergenic
1019015406 6:168876474-168876496 TGGGTAACTCGCCTCTGTGCAGG + Intergenic
1021828733 7:24581300-24581322 AGGGAAATCTCCCTCTGTGAAGG + Intronic
1021872043 7:25016563-25016585 CTGGAAACTTCCCTCTGTCCTGG - Intergenic
1026513664 7:71048636-71048658 AGGGAAACTTCCCCATGTCTTGG + Intergenic
1027291227 7:76713144-76713166 AGGGAGCCTTCACTTTGTGCTGG - Intergenic
1028437697 7:90823493-90823515 AGGGCTTCTTCTCTCTGTGCCGG - Intronic
1028750211 7:94374454-94374476 AGGGCAAACTCCCTCTGTGAAGG - Intergenic
1028996526 7:97106330-97106352 AGTGAAACTTCTCTCTGAGGAGG - Intergenic
1030304124 7:108002531-108002553 AGGGAACCTGCCCTCTGCGGTGG + Intronic
1031206399 7:118763941-118763963 AGGGAAGCCTCTCTCTGAGCTGG - Intergenic
1033261932 7:139851501-139851523 AGGGAAACTTCACCCTGGGGTGG - Intronic
1034176596 7:149104799-149104821 AGGGCCTCTTCCCGCTGTGCTGG + Exonic
1035178536 7:157072258-157072280 AGGCAATCTCCTCTCTGTGCCGG + Intergenic
1035560190 8:598470-598492 AGGGGAATTTACCTCTGTGAAGG - Intergenic
1037290322 8:17343058-17343080 AGGAAGAATTCCCTCTGAGCAGG - Intronic
1038306774 8:26410870-26410892 AGGGAAACTTGCCTTTGTCTTGG - Exonic
1038584891 8:28779526-28779548 AAGCAAACTTCCCGCTATGCCGG + Intronic
1039207054 8:35168553-35168575 AGGGAAAATTCCCTATGAACTGG + Intergenic
1039227112 8:35400473-35400495 AGGGACACTTTCTTCTTTGCTGG + Intronic
1039799103 8:40938879-40938901 AGGGAAAGTCCCCTCTCTTCCGG + Intergenic
1042533745 8:69839058-69839080 AGGGAAACTTCCCTGTGAAGAGG + Intergenic
1044256135 8:90064530-90064552 AGGGAAACTCCCATCTGAGTGGG + Intronic
1048976061 8:139673809-139673831 ATGAAAACTTTCCTCTCTGCAGG - Intronic
1049639022 8:143706044-143706066 AGGAGAACATCCCTCTGTTCAGG + Intronic
1052374728 9:27706158-27706180 AGGGAAATATCTCTCTGTACAGG + Intergenic
1053082150 9:35185235-35185257 AGAGAAACTTCTCTTTGTGGAGG + Intronic
1057826437 9:98375786-98375808 AATGAAACCTCCCTCAGTGCAGG - Intronic
1061211837 9:129198217-129198239 AGAGTAACTGCCCTCTGTCCGGG + Intergenic
1188148035 X:26638549-26638571 AAGGAATCTTCCTTCTTTGCTGG - Intergenic
1191181970 X:57574004-57574026 AGGGGAACTTCCCTCAAAGCAGG + Intergenic
1192203515 X:69081896-69081918 TGGGAAACTACCCCCTGTGGTGG + Intergenic
1193051894 X:77110976-77110998 AGTCTAACTTCCCTCTTTGCTGG - Intergenic
1198126204 X:133646484-133646506 TGGGAAACTTCCTTATTTGCAGG - Intronic