ID: 1062803294

View in Genome Browser
Species Human (GRCh38)
Location 10:395902-395924
Sequence GCATAGCAGGAGAACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062803294_1062803297 -10 Left 1062803294 10:395902-395924 CCCACACTGTTCTCCTGCTATGC 0: 1
1: 0
2: 1
3: 13
4: 230
Right 1062803297 10:395915-395937 CCTGCTATGCTCCCTGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062803294 Original CRISPR GCATAGCAGGAGAACAGTGT GGG (reversed) Intronic
904343011 1:29849982-29850004 GCATTGACGGAGAACAGAGTCGG + Intergenic
905273122 1:36800110-36800132 GCAAAGCAGGAGACCACAGTGGG - Exonic
906140044 1:43528901-43528923 GCAGAGCAGGAGAAAAGAGGAGG + Intronic
909566374 1:77057702-77057724 GCATCAGAGGAGAACAGTGAAGG + Intronic
909858782 1:80576071-80576093 CCATATCAAGAGATCAGTGTTGG + Intergenic
912158669 1:106953825-106953847 GTATAGCAGTATAACTGTGTGGG - Intergenic
912392977 1:109317612-109317634 GCAGAGCAGGAGAACAAGCTCGG - Intronic
915002279 1:152604256-152604278 CCATAGCAGGAGAAGACTGAAGG - Intergenic
916858301 1:168774768-168774790 GCAGAGGATGAGAAAAGTGTGGG - Intergenic
917995893 1:180438010-180438032 GCACAGCAGGAGATGAGTGGCGG + Intronic
918407259 1:184223435-184223457 GCACAGCAGGAGGTGAGTGTGGG - Intergenic
918695759 1:187544472-187544494 GGATATTAGGAGAACAGTTTGGG - Intergenic
919148876 1:193669525-193669547 GCACAGCAGGAGGTCAGTGGAGG + Intergenic
919393468 1:197015982-197016004 CCATTTCAGGAGATCAGTGTTGG + Intergenic
920788126 1:209062413-209062435 GCAGTGCAGGAGCACAGGGTGGG - Intergenic
922750663 1:228068686-228068708 GCGTAGTAGGAGCACGGTGTAGG + Intergenic
924119694 1:240783783-240783805 GGATTGCAGGAGAAGAATGTAGG - Intronic
1062803294 10:395902-395924 GCATAGCAGGAGAACAGTGTGGG - Intronic
1070493762 10:77001921-77001943 TCATATCAGGGGAAAAGTGTTGG - Intronic
1071099044 10:82013274-82013296 GACTATCAGGAGAACAGTATGGG + Intronic
1071399050 10:85251551-85251573 TCACAGAAGGACAACAGTGTGGG - Intergenic
1072796270 10:98357181-98357203 TCATATCAGGAGAGAAGTGTAGG + Intergenic
1073686467 10:105759807-105759829 GAAAAGCCGGAGAACAGTGAGGG + Intergenic
1074632394 10:115273095-115273117 CCATATCAGGAGCTCAGTGTTGG + Intronic
1075224575 10:120615494-120615516 TCATAGCAGAAGTATAGTGTTGG + Intergenic
1075494717 10:122909927-122909949 CCATAGCAGTAGAACAGGGGAGG - Intergenic
1075752925 10:124788550-124788572 GCATAGCAAGAGCACACTGCAGG + Intronic
1076781935 10:132729220-132729242 GCATGGCGGGAGAACAGTGCAGG + Intronic
1077652025 11:3981545-3981567 GCAAAGGAGGAGTACAGAGTGGG + Intronic
1077659461 11:4054455-4054477 GCACAGCAGGAGATGAGTGGTGG + Intronic
1078087248 11:8241517-8241539 GTATGGCTGGAGCACAGTGTGGG - Intronic
1080299719 11:30770441-30770463 TAATGGCAGGAGAACAGTGGAGG - Intergenic
1080954537 11:37078075-37078097 GCACAGCAGGAGATGAGTGGCGG - Intergenic
1081262433 11:40977229-40977251 GCATAGGAGGAGATGAGTGGTGG - Intronic
1082127995 11:48455084-48455106 CCAGAGCAGGAGCAAAGTGTGGG + Intergenic
1082561545 11:54626011-54626033 CCAGAGCAGGAGCAAAGTGTGGG + Intergenic
1083038191 11:59659838-59659860 GCTTAGCAGAAGAATTGTGTAGG - Intronic
1083402113 11:62430733-62430755 GCAGAAGAGGAGATCAGTGTCGG - Intergenic
1083671659 11:64303544-64303566 GCAGAGCAGCAGAGCAGGGTTGG + Exonic
1084043833 11:66557726-66557748 CCATGGCTGGAGAACCGTGTGGG + Exonic
1084559991 11:69899238-69899260 GCATAGCAGGTGCACAGTCAGGG - Intergenic
1088325378 11:108595457-108595479 GAATAGCAGAAGTACAGTCTAGG + Intergenic
1090489068 11:127141935-127141957 ACTGAGCAGGAGTACAGTGTTGG - Intergenic
1091536395 12:1414125-1414147 GCACAGCAGGAGAGGAGTGGCGG - Intronic
1091776179 12:3186300-3186322 GCAGAGCAGGAGAAGAGAGATGG + Intronic
1093746131 12:22742653-22742675 GCAAAGCAGGAGAAATATGTAGG - Intergenic
1096868190 12:54577571-54577593 GAACAGCAGCAGAACAGGGTGGG + Intronic
1097488211 12:60232742-60232764 GCACAGCAGGAGGTCAGTGGTGG + Intergenic
1098068356 12:66644125-66644147 CTCTACCAGGAGAACAGTGTGGG + Intronic
1101976717 12:109365871-109365893 GCACAGCAGGAGATGAGTGGTGG + Intronic
1102698433 12:114817947-114817969 GCATAGCAGGAGGACAATCTTGG - Intergenic
1103015096 12:117488029-117488051 CAATACCAGGAGAACAGTATGGG - Intronic
1103175231 12:118857707-118857729 CCATAGGAGGAGAAGAGTGGAGG + Intergenic
1104668962 12:130667492-130667514 GCATGGGAGGAGAGCAATGTGGG + Intronic
1105286480 13:19008588-19008610 GAATAGCAGAAGAGCAGTGCAGG - Intergenic
1108517870 13:51220209-51220231 TCAGAGCCTGAGAACAGTGTTGG - Intergenic
1110477015 13:75928067-75928089 GCATAGCAGGAGGTAAGTGGAGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1113269160 13:108654312-108654334 TCCTAGCACGAGAACAGTATGGG - Intronic
1113407855 13:110057885-110057907 ACATAGCAAGAGAAAAGAGTGGG + Intergenic
1113723665 13:112581098-112581120 GAATAGCAGGAGTGCAATGTGGG - Intronic
1115296996 14:31839940-31839962 GAATAGCAAAAGAAAAGTGTTGG + Intronic
1117871956 14:60210584-60210606 CACTACCAGGAGAACAGTGTGGG + Intergenic
1119112829 14:71990865-71990887 GCTCAGAAGGAGAACAGTTTTGG - Intronic
1119655978 14:76417328-76417350 GAAGAGCAGGAGACCAGTGTGGG + Intronic
1120773322 14:88405701-88405723 GCAAAGCAGTAGTTCAGTGTTGG + Intronic
1121426054 14:93852946-93852968 GCAGAGCAGGAGAACAGGAGGGG - Intergenic
1123559153 15:21467596-21467618 GAAAAGAAGGAGAAAAGTGTTGG + Intergenic
1123595384 15:21904877-21904899 GAAAAGAAGGAGAAAAGTGTTGG + Intergenic
1124917830 15:33994120-33994142 GCATAGCAGGAGGTGAGTGGTGG + Intronic
1126315367 15:47363974-47363996 CACTATCAGGAGAACAGTGTGGG + Intronic
1126973648 15:54149033-54149055 CCCTAGCAGGAGAACAGCCTGGG - Intronic
1127885456 15:63195771-63195793 TCATAGCATGAGAAGAGGGTTGG + Intronic
1128765969 15:70251351-70251373 GCATAGGTGGAGAAGAGGGTTGG + Intergenic
1129946884 15:79546239-79546261 GCATGGGAGGAGAACACTGCGGG - Intergenic
1202967501 15_KI270727v1_random:194755-194777 GAAAAGAAGGAGAAAAGTGTTGG + Intergenic
1134423117 16:14112765-14112787 AGATACCTGGAGAACAGTGTTGG - Intronic
1134787268 16:16955923-16955945 GCACAGCAGGAGATGAGTGGTGG + Intergenic
1136452730 16:30363064-30363086 GCATATCAGGAGCTCAGTTTTGG - Intronic
1136508524 16:30721814-30721836 GCCTAGCAGTAGAAAAGTATTGG + Intronic
1138213708 16:55184509-55184531 GCATGGCAGGTGAACAGAGCTGG - Intergenic
1138229318 16:55325795-55325817 GAAAAGCTGGAGAACAGTGGAGG - Intronic
1140580846 16:76229096-76229118 GACTACCAGGAGAACAGTATGGG - Intergenic
1141033123 16:80606769-80606791 CACTACCAGGAGAACAGTGTGGG - Intronic
1143219254 17:5247719-5247741 GCATAGCAGGAGGTGAGTATTGG + Intergenic
1143381851 17:6501567-6501589 GCAGAGCAGGAGAACCATGCAGG - Intronic
1144059279 17:11567991-11568013 GCACAGCAGGAGGACAGAGTGGG + Intergenic
1147583621 17:41639939-41639961 GCAAAACAGGAGAACAGGGCAGG + Intergenic
1151573695 17:74940516-74940538 GCATAGCAGGAGGTAAGTGATGG + Intronic
1152092244 17:78253372-78253394 GCAGTGCAGGAGAACAGTTGTGG + Intergenic
1152305737 17:79519277-79519299 GCATGGCAGGAGCACTCTGTGGG - Intergenic
1152863550 17:82709464-82709486 GCATGGCAGGAGAGCAGAGGTGG - Intergenic
1155383965 18:25256750-25256772 GCTAGGAAGGAGAACAGTGTTGG + Intronic
1155856647 18:30842959-30842981 TCATATCATGAGAACAGTATGGG - Intergenic
1155924789 18:31643803-31643825 GCATACTAGTAGAACAGTTTAGG - Intronic
1157925791 18:51764872-51764894 TCATAGAAGGAGACCAGGGTGGG + Intergenic
1158081253 18:53593485-53593507 ACTTACCAGGAGAACAGTGTGGG - Intergenic
1158285294 18:55874110-55874132 GCATAGCAGGAGGTGAGTGGCGG - Intergenic
1158343030 18:56487032-56487054 GCATAGTTGAGGAACAGTGTTGG + Intergenic
1158871606 18:61693713-61693735 GTATAGGAGAAAAACAGTGTTGG + Intergenic
1159534898 18:69703714-69703736 GCATAGCAGGGGAAGAAGGTGGG + Intronic
1164663606 19:30004297-30004319 GCATAGCATGAGAGCCGTATCGG + Intronic
1166166920 19:40997181-40997203 GGAGAGCAGGAGAGGAGTGTGGG + Intronic
1167170153 19:47825581-47825603 GCTCAGCAGGAGGAAAGTGTGGG - Intronic
925254951 2:2475476-2475498 GCAGAGAAGGGGAACAGTCTTGG + Intergenic
925290131 2:2742295-2742317 GCATAGCAGGGGAGAAGTGGAGG + Intergenic
925536371 2:4922312-4922334 CACTACCAGGAGAACAGTGTGGG + Intergenic
927364745 2:22281352-22281374 GCAGAGGAGGAGAACAGAGCAGG + Intergenic
927835686 2:26396794-26396816 GCACAGCTGGAGAACAGCCTGGG - Intergenic
927972173 2:27312658-27312680 GGTGAGCAGGAGAACAGAGTGGG - Exonic
930590381 2:53320043-53320065 TCATGGCAGGAAGACAGTGTAGG - Intergenic
932576998 2:72968193-72968215 GGATACCAGGATAACAGTGCTGG - Intronic
935008907 2:99112696-99112718 GCATGGCTGGAGCACAGTGAGGG + Intronic
935394286 2:102589177-102589199 TCATAGAAGAAGCACAGTGTGGG + Intergenic
935923721 2:108043036-108043058 ACCTAGCATGAGAACAGTATGGG - Intergenic
936515483 2:113178843-113178865 GCATGGCAGGAGAACTATTTGGG + Intronic
936829829 2:116630469-116630491 GAGTAGCAGGTAAACAGTGTCGG - Intergenic
936964735 2:118116628-118116650 GCCTAGAAGGAGAAATGTGTGGG + Intergenic
937333974 2:121049457-121049479 GCATAGCAGGAGCAGAGTCTGGG - Intergenic
937518599 2:122684647-122684669 ACCTACCATGAGAACAGTGTGGG + Intergenic
937915087 2:127094955-127094977 CCAGACCAGGAGAACAGGGTGGG + Intronic
938953242 2:136276547-136276569 CCCTACCAGGAGAACAGTATGGG + Intergenic
940505732 2:154550537-154550559 GCTAATCAGGAGAACAGTGTTGG - Intergenic
940661584 2:156552003-156552025 GCATAGCAGGATAGCATTCTAGG - Intronic
941339526 2:164289597-164289619 ACATAGCAGGGGTACAGAGTGGG + Intergenic
941907369 2:170729867-170729889 GCAAAGCTGGAAAACAGTGATGG - Intergenic
941959317 2:171238118-171238140 GCACAGCAGGAGCCCAGTGATGG + Intergenic
942969084 2:181935185-181935207 TCATAGTAGGAACACAGTGTGGG + Intergenic
944593971 2:201244945-201244967 GCATCTCAGGGGAACAGTCTGGG - Intronic
945123560 2:206484531-206484553 GCACAGAATAAGAACAGTGTAGG + Intronic
945452040 2:210005043-210005065 GCAAAGGAGGAAACCAGTGTAGG + Intronic
1172254777 20:33508046-33508068 GAATAGCAGGAGATGAGAGTAGG + Intronic
1172896069 20:38300889-38300911 AAATAGCAGGAGAAGAGTTTTGG + Intronic
1175679220 20:60973237-60973259 GCATGGCAGGAGAGCTGTCTAGG - Intergenic
1175752406 20:61508508-61508530 GCAGAGCAGGTGGACAGTGGCGG + Intronic
1175977177 20:62716916-62716938 GCATGGCGGGGGAACAGTGGGGG - Intronic
1176245441 20:64094698-64094720 GAATAGCAGGGGGATAGTGTGGG + Intronic
1178023736 21:28440651-28440673 GAATAAAAGGATAACAGTGTGGG - Intergenic
1178133270 21:29597453-29597475 ACATAAGAGGAGAACAGAGTTGG + Intronic
1181020152 22:20096066-20096088 GCATAGCAGGACATGAGTGGTGG - Intronic
1181846808 22:25716811-25716833 GCACAGCAGGAGATCAGTGCTGG + Intronic
1182303171 22:29350153-29350175 GCATGGGAAGAGAAGAGTGTGGG + Intronic
1183653701 22:39173292-39173314 GCATAGCAGGAGCACAGGCGTGG - Intergenic
1184190756 22:42892832-42892854 GCACAGAAGCAGAGCAGTGTGGG - Intronic
952829163 3:37549139-37549161 GCATAGCTGGAGAACAAACTGGG + Intronic
953927231 3:46988640-46988662 GCAGAACAGGGGAACAGTGGTGG - Intronic
954106344 3:48411680-48411702 GCTTAGCAGGATAGCAGTTTAGG - Intronic
954293444 3:49661677-49661699 GCATAGCAGCAGGGCAGTGTGGG - Exonic
956044918 3:65185448-65185470 GGATAACAGGAGAGAAGTGTAGG + Intergenic
956853380 3:73253060-73253082 GAAGAACAGGAGAACAGTCTGGG - Intergenic
957430887 3:80104938-80104960 GCATATCACCAGAACAGTTTGGG - Intergenic
957796340 3:85013281-85013303 GCATAGCAGGAGAGAACTATAGG - Intronic
957918415 3:86716250-86716272 TCATACCACGAGAACAGTATGGG - Intergenic
957952753 3:87146176-87146198 GCAGAGCAGGACAACACAGTTGG + Intergenic
958087141 3:88824941-88824963 GCACAGCTGGAGTACAGTGGGGG + Intergenic
959154682 3:102652612-102652634 GCTTAGAAGGATAACTGTGTGGG + Intergenic
960425382 3:117500656-117500678 GTCTACCAGGAGAACAGTATGGG + Intergenic
962717206 3:138136966-138136988 ACATAGCAAGAGGACAGAGTAGG - Intergenic
963474818 3:145791622-145791644 GCTTCGCAGCAGGACAGTGTTGG - Intergenic
964028477 3:152107232-152107254 GATAACCAGGAGAACAGTGTTGG - Intergenic
966639999 3:182179109-182179131 GCATAGTAGGAGACCAGTACAGG - Intergenic
969095865 4:4732224-4732246 CCAGAGCAGGAGAAAAGTGGGGG - Intergenic
971977695 4:33711356-33711378 GTATACCATGAGAACAGTATGGG + Intergenic
977722570 4:100257122-100257144 GCCTAGCAGGAAAAGAGTCTGGG + Intergenic
980852703 4:138402628-138402650 GACTAGCATGAGAACAGTATAGG + Intergenic
980875967 4:138662461-138662483 GCAAAGCAGGAAGACAGGGTAGG - Intergenic
981837548 4:149072761-149072783 GAGTACCAGGAGAACAGTATGGG - Intergenic
981944945 4:150330691-150330713 GCATAGCAGGAGGTGAGTGGTGG - Intronic
984150619 4:176125667-176125689 GCATAGTAGGATGACAGTGAAGG + Intronic
986013955 5:3741034-3741056 GCATGGCAGGGCCACAGTGTAGG + Intergenic
986778701 5:11044845-11044867 GCAGAGCTGGAGAAAAATGTAGG + Intronic
988426710 5:31073471-31073493 TCATACCATGAGAACAGTATGGG + Intergenic
990020952 5:51127252-51127274 TCATATCATGAGAACAGTATGGG - Intergenic
990132844 5:52609090-52609112 CACTAGCAGGAGAACAGTATGGG - Intergenic
990943846 5:61229961-61229983 GCTGACCAGGAGAACAGGGTGGG - Intergenic
992279837 5:75162740-75162762 ACATAACATGAGAACAGTATGGG - Intronic
994292263 5:98041928-98041950 ACATAGCAAGACTACAGTGTAGG + Intergenic
996080239 5:119251073-119251095 GCACAGCAGGAGGTGAGTGTTGG + Intergenic
996463522 5:123773636-123773658 GCATTGGAGGAGATCAGGGTTGG - Intergenic
999348364 5:150844279-150844301 GCCTAGCAGGAGAATGGAGTGGG - Intergenic
1000695128 5:164371506-164371528 CAATATCAGGAGAACAGTGTAGG + Intergenic
1003661608 6:8067620-8067642 GCAAAGGAGGAGAAAAGAGTAGG + Intronic
1004183113 6:13397642-13397664 GCAAAACAGGAGAGCAGGGTGGG + Intronic
1007131189 6:39475610-39475632 GCATACCTGCAGAAAAGTGTGGG + Intronic
1009995817 6:70894114-70894136 ACATGGCAGGTGAGCAGTGTGGG - Exonic
1010597258 6:77778876-77778898 GCCTGGAAGGAGAACAGTCTTGG + Intronic
1010953439 6:82063621-82063643 GCATAGAAGGAAAACAGTGTTGG + Intergenic
1012298130 6:97550010-97550032 CACTACCAGGAGAACAGTGTGGG + Intergenic
1012719231 6:102720382-102720404 GCATTGTAGTAGACCAGTGTAGG - Intergenic
1015372132 6:132466082-132466104 GAATGGGAGGAGAACAGTGGTGG - Intronic
1015985654 6:138881846-138881868 GCATAGCAGGAGGTGAGTGGGGG - Intronic
1016017203 6:139198644-139198666 GCATGGCAGGAGACCAATGCAGG + Intergenic
1016241748 6:141939480-141939502 CAATATCACGAGAACAGTGTGGG - Intergenic
1016244464 6:141966272-141966294 CACTAGCAGGAGAACAGTATGGG + Intergenic
1017187684 6:151618615-151618637 GCATAGCAGGAGAAGAGGTATGG - Exonic
1018243955 6:161804041-161804063 CCACAGCAGGAGAACACTGACGG + Intronic
1018449751 6:163896641-163896663 CACTACCAGGAGAACAGTGTGGG - Intergenic
1018915226 6:168128831-168128853 GAAACGCAGGAGGACAGTGTGGG + Intergenic
1020513737 7:9090683-9090705 CCATAGCAGTAGCACAGGGTTGG - Intergenic
1022184480 7:27953998-27954020 GCATGGCAGGACACCAGGGTGGG - Intronic
1023572693 7:41588727-41588749 TCATAGCAGAAGAAGAGCGTTGG - Intergenic
1024841845 7:53595981-53596003 GCAGAGCAGGGGAGCAGTTTAGG - Intergenic
1024914764 7:54486901-54486923 TCATACCAAGAGAACAGTATGGG + Intergenic
1028798896 7:94938116-94938138 GCATAGCAGGAGGTGAGTGGTGG + Intronic
1029715775 7:102324638-102324660 GCAGAGCAGGAGGACAGTGACGG + Intergenic
1031150444 7:118048000-118048022 GCATATCAGAAGCACAGTGCAGG - Intergenic
1034044193 7:147910744-147910766 CCCTACCAGGAGAACAGTATGGG + Intronic
1034878797 7:154748433-154748455 GCTCACCAGGAGCACAGTGTGGG - Intronic
1037254404 8:16936255-16936277 GCATAGCAGGAGGTGAGTGGTGG - Intergenic
1038913462 8:31993476-31993498 ACTTACCAGGAGAACAGTATGGG - Intronic
1039339890 8:36636172-36636194 GCCAAGCAGGAGAATAGTGTAGG - Intergenic
1040434007 8:47371968-47371990 CAATAGCAGGAGAACAGAGATGG - Intronic
1045891571 8:107164199-107164221 GCACAGCAGGAGGTGAGTGTTGG + Intergenic
1045980855 8:108185580-108185602 GCATAGCAGGAGGTGAGTGGAGG - Intergenic
1046357261 8:113104085-113104107 GCATAGTATGAGATCAGTATTGG - Intronic
1047657402 8:126992879-126992901 AGATAGCAGGAGAACTGTATAGG + Intergenic
1048456062 8:134579467-134579489 CCCTAGCACGAGAACAGTATGGG + Intronic
1052642771 9:31190808-31190830 CATTACCAGGAGAACAGTGTGGG - Intergenic
1055321352 9:75086445-75086467 GCATAGCAGGAGAACAAACTAGG + Intronic
1055680009 9:78704983-78705005 CACTATCAGGAGAACAGTGTGGG - Intergenic
1057445962 9:95114832-95114854 GAAAAGCATGAGAACAGTATTGG - Intronic
1057517919 9:95737408-95737430 GCAGAGGATGAGAACAGCGTGGG - Intergenic
1058039000 9:100283654-100283676 GGGTAGCAGGAGAACAGAGAAGG - Intronic
1058628606 9:106961975-106961997 GCACAGCATGGAAACAGTGTGGG + Intronic
1058842309 9:108921885-108921907 TCATAGCATCAGCACAGTGTAGG - Intronic
1059567654 9:115399336-115399358 GCATAGCAGCACAGCAGTTTAGG + Intronic
1059701605 9:116780467-116780489 GCATTTCTGGGGAACAGTGTGGG + Intronic
1060673873 9:125494815-125494837 GCATAGCAGGGGACCAGAGCAGG - Intronic
1061851859 9:133420920-133420942 CTATGGCAGGAGGACAGTGTGGG + Intronic
1061867475 9:133500329-133500351 CACTATCAGGAGAACAGTGTGGG - Intergenic
1185973899 X:4696863-4696885 GACTACCACGAGAACAGTGTAGG + Intergenic
1186154083 X:6707721-6707743 GCACAGCAGGAGATGAGTGGCGG - Intergenic
1187757180 X:22540728-22540750 GTATAGCGGCAGAAGAGTGTGGG - Intergenic
1187796062 X:23005787-23005809 GACTATCATGAGAACAGTGTGGG + Intergenic
1188018797 X:25134673-25134695 GACTATCAGGAGAACAGTATGGG - Intergenic
1188594357 X:31879339-31879361 GATTATCAGGAGAACAGTATGGG + Intronic
1190417118 X:50191069-50191091 GCAGAGAAGGGGTACAGTGTAGG - Exonic
1192394238 X:70762444-70762466 GCACAGCAGGAGATGAGTGGCGG + Intronic
1194257060 X:91646999-91647021 TCATACCATGAGAACAGTATGGG - Intergenic
1194473829 X:94334548-94334570 CCATACCACGAGAACAGTATGGG - Intergenic
1195788435 X:108554410-108554432 CACTATCAGGAGAACAGTGTGGG + Intronic
1195922373 X:109996370-109996392 GCACAGCAGGAGATGAGTGGTGG - Intergenic
1200575770 Y:4886265-4886287 TCATACCATGAGAACAGTATGGG - Intergenic
1201426851 Y:13860580-13860602 ACATAGCAGGAGATGAGTGGTGG - Intergenic
1201630151 Y:16062926-16062948 GCATAGCTGGAAAACAGAGACGG + Intergenic