ID: 1062805310

View in Genome Browser
Species Human (GRCh38)
Location 10:415383-415405
Sequence AAGGAGAGGCAGCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062805300_1062805310 19 Left 1062805300 10:415341-415363 CCAGGAGCATTCAGGGGCAAAGG 0: 1
1: 0
2: 0
3: 16
4: 214
Right 1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG No data
1062805299_1062805310 20 Left 1062805299 10:415340-415362 CCCAGGAGCATTCAGGGGCAAAG 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062805310 Original CRISPR AAGGAGAGGCAGCAGGAGGA GGG Intronic
No off target data available for this crispr