ID: 1062805395

View in Genome Browser
Species Human (GRCh38)
Location 10:416034-416056
Sequence CATGCTGTACGGTAGCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 21}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062805391_1062805395 -1 Left 1062805391 10:416012-416034 CCTGGGAAGGGCCCGAGGTGATC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1062805395 10:416034-416056 CATGCTGTACGGTAGCCCCGTGG 0: 1
1: 0
2: 1
3: 1
4: 21
1062805388_1062805395 11 Left 1062805388 10:416000-416022 CCTAGATGCGATCCTGGGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1062805395 10:416034-416056 CATGCTGTACGGTAGCCCCGTGG 0: 1
1: 0
2: 1
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062805395 Original CRISPR CATGCTGTACGGTAGCCCCG TGG Intronic
902527915 1:17071317-17071339 CATTCTCTACGGAAGCCCCAAGG + Intronic
924718631 1:246602484-246602506 CATGGTGTAAGGCAGCCCTGTGG - Intronic
1062805395 10:416034-416056 CATGCTGTACGGTAGCCCCGTGG + Intronic
1089948769 11:122505997-122506019 CATCCTGTACGCTAGCCTCCGGG - Intergenic
1090291150 11:125546013-125546035 CTTGCTGCACGATAGCCCTGGGG - Intergenic
1092963815 12:13622370-13622392 CATTCTGTCCTGCAGCCCCGGGG + Intronic
1096898479 12:54849906-54849928 CAGGGTGTAGGGGAGCCCCGTGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1125693710 15:41617738-41617760 CATGTTGTAAGGTAGGCCTGTGG + Intergenic
1140619083 16:76705998-76706020 CATACTGTGGGGTAGCCCTGGGG - Intergenic
1156703536 18:39853038-39853060 CAGGCTGTATAGTAGCCCCAGGG - Intergenic
1157123851 18:44936822-44936844 CATATTGTCAGGTAGCCCCGAGG + Intronic
1176044184 20:63083916-63083938 CCTGCTGTCAGGAAGCCCCGGGG - Intergenic
1176106404 20:63391636-63391658 CATGCTGTGAGGAAGCCCAGAGG - Intergenic
1178629601 21:34247730-34247752 CATGCTGTAAGGTAGCCCTGTGG + Intergenic
953892006 3:46757540-46757562 CAGGCTGTACGCAAACCCCGGGG - Intronic
954624029 3:52012705-52012727 CATGCTGAGCTATAGCCCCGTGG + Intergenic
956050259 3:65240466-65240488 CATGATGGACAGTAGCCACGTGG - Intergenic
961378730 3:126483416-126483438 CGTGCTGGACGGTACCCCGGAGG - Exonic
986330799 5:6714586-6714608 CCTGCTGTCCGGCAGCCGCGCGG + Exonic
1003499147 6:6690028-6690050 CTTGCTGTACGGAAGCCATGAGG - Intergenic
1049757166 8:144315857-144315879 CATTGTGTACCGTAGCCCCTCGG + Exonic
1062728878 9:138097350-138097372 CATGCTGTACGGGACCCCCATGG - Intronic
1189007638 X:37011091-37011113 CATGCTGTACTTCAGCCCTGAGG - Exonic