ID: 1062808172

View in Genome Browser
Species Human (GRCh38)
Location 10:440791-440813
Sequence AAACCCCTGATTGCTGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062808172 Original CRISPR AAACCCCTGATTGCTGGGCT AGG Intronic
900140274 1:1136907-1136929 ACACCCCCGCTGGCTGGGCTGGG + Intergenic
902727815 1:18348919-18348941 CAAACCCAGATTGCTTGGCTTGG - Intronic
903348427 1:22702804-22702826 AGACTCCTGAATGCTGGGCTGGG - Intergenic
903510888 1:23874193-23874215 AAGTCCCTCATTGCTGGGCCTGG + Exonic
913165016 1:116177187-116177209 AAAGCCCAGATTGCTGGGCTTGG - Intergenic
915122488 1:153639169-153639191 AAACCTTTGACTGCTGGGCGCGG - Intronic
920604501 1:207367580-207367602 AAATGGCTGATTTCTGGGCTAGG + Intergenic
920774343 1:208921589-208921611 AAACCCCTTTTGGCTGGGCAAGG + Intergenic
1062808172 10:440791-440813 AAACCCCTGATTGCTGGGCTAGG + Intronic
1062916961 10:1247935-1247957 AGATCCTTGATTGCTGGGATGGG + Intronic
1067256628 10:44648299-44648321 AAACCCTTGAATGCTTGGCAGGG + Intergenic
1067525379 10:47035408-47035430 AGCCCCCTGATTCCTGGGGTCGG + Intergenic
1076677478 10:132154635-132154657 AAGACCCTGCCTGCTGGGCTGGG - Intronic
1076738539 10:132469323-132469345 AAACCCGTGAAAGCTAGGCTCGG + Intergenic
1077515426 11:2998927-2998949 AAAAACTTGATTGCTAGGCTGGG + Intergenic
1078467449 11:11560694-11560716 CTACCCATGACTGCTGGGCTGGG - Intronic
1080100481 11:28454070-28454092 AATCCTCTGATTGATGGACTTGG + Intergenic
1080336004 11:31196715-31196737 AAAACCCTGAATGGTGGGTTTGG - Intronic
1081809426 11:45906781-45906803 AAGCCCCTGAAGGCTGGACTTGG + Intronic
1085403335 11:76247376-76247398 AAGCCCCTGATACCTGGGCATGG + Intergenic
1086408394 11:86519513-86519535 AAGCCCTTTATTGCTGGACTTGG - Intronic
1088226607 11:107627141-107627163 AAACCTCAGCTTGCTGTGCTAGG - Intronic
1089773413 11:120819274-120819296 ATACACCTGTTGGCTGGGCTGGG + Intronic
1091290378 11:134436132-134436154 AATCCCCTGACTGCTGCACTGGG - Intergenic
1091308677 11:134557769-134557791 ACACCCCTGCTGGCTGGGGTGGG - Intergenic
1094611490 12:31999607-31999629 CAACCCCTGCCTCCTGGGCTTGG + Intergenic
1096598069 12:52709823-52709845 AATCCTCTGATTTCTGGGTTGGG + Intergenic
1096821453 12:54238721-54238743 AGCCCTTTGATTGCTGGGCTGGG - Exonic
1098141791 12:67457550-67457572 ACACCACTGTTTGCTGGGTTAGG + Intergenic
1100440151 12:94609450-94609472 TAACCACTGATTACTGGACTTGG - Intronic
1101946824 12:109143677-109143699 AAGCCCCTGATTCTGGGGCTGGG - Intronic
1102111110 12:110366378-110366400 GAACCCCTAAGTGCTGGGCCTGG - Intergenic
1102819379 12:115894968-115894990 TAACCCTTCATTGCAGGGCTGGG - Intergenic
1105339848 13:19511592-19511614 AAACGGCTGATTCCAGGGCTGGG + Intronic
1107539470 13:41373546-41373568 AAACCCTTTATGGCTGGGCGCGG - Intronic
1109459877 13:62642851-62642873 TTACGCCTGATTGCTGAGCTAGG + Intergenic
1110497710 13:76188905-76188927 GTACCCTTGCTTGCTGGGCTTGG + Intergenic
1111507190 13:89207675-89207697 AAATGCCTGATTCCAGGGCTGGG + Intergenic
1115125362 14:29986269-29986291 AAATCCATCATTGCTGGGATAGG + Intronic
1115726998 14:36227879-36227901 TAACTCCTGATTGCAGGGCAGGG + Intergenic
1117676810 14:58163691-58163713 AAAACCCTCTTGGCTGGGCTTGG - Intronic
1121555896 14:94836809-94836831 CAGCCCATAATTGCTGGGCTCGG - Intergenic
1123158974 14:106258798-106258820 CAACCCCTGTGTGCTGGGCTTGG - Intergenic
1123160086 14:106269643-106269665 TGACCCCTGTGTGCTGGGCTTGG - Intergenic
1123212747 14:106776194-106776216 CAACCCCTGTGTGCTGGGCTTGG - Intergenic
1202893357 14_KI270722v1_random:180708-180730 ATACCCCTGCTTCCTGGGCTAGG - Intergenic
1124638381 15:31379543-31379565 AGACCCCTCATTCCTGGGATGGG - Intronic
1124920789 15:34024357-34024379 AAACCTCTGAAGGCTGGGCGTGG + Intronic
1125637105 15:41198259-41198281 AAACCCATGATTAGAGGGCTGGG + Intronic
1129289794 15:74556080-74556102 AAAGCCCAGATAGCCGGGCTCGG - Intronic
1129465631 15:75722773-75722795 AAACCTCTGATTTCTGGGTAAGG - Intergenic
1130867304 15:87943805-87943827 AAACCCCTGGTTGCAGGAGTGGG + Intronic
1132112584 15:99113207-99113229 AAACCCCTGATTTCTAGTCTTGG + Intronic
1132835525 16:1951057-1951079 GGACCCCTGCTTGGTGGGCTGGG - Intronic
1133976263 16:10601717-10601739 AGCTCCCTGAATGCTGGGCTGGG - Intergenic
1135127132 16:19820357-19820379 AAACACAAAATTGCTGGGCTTGG + Intronic
1135395620 16:22129625-22129647 AAACCCCTTATTTCTTGGCTAGG - Intronic
1137633159 16:49962360-49962382 AAACCCATGTTTGTTGGGATGGG + Intergenic
1138348843 16:56335760-56335782 AGACCCCGCCTTGCTGGGCTGGG - Intronic
1139279080 16:65754342-65754364 AAAACCCTAATTCCTGGGCCAGG + Intergenic
1140455230 16:75101263-75101285 AACACCCTTATTGCTGGGCGCGG + Intronic
1141300776 16:82813628-82813650 AGACCCCAGATTGCTGGGGCTGG + Intronic
1142413830 16:89930391-89930413 AAACCACTCATAGCTGGGCACGG - Intronic
1142615515 17:1132060-1132082 AAAACCCTCCTTGCTGGGCGCGG + Intronic
1142803973 17:2362042-2362064 AAACCCCAGAATGCTGGCATTGG - Intronic
1145035154 17:19535459-19535481 AAACACCTCATGGCTGGGCGTGG + Intronic
1146647503 17:34584912-34584934 AAACTCAAGGTTGCTGGGCTGGG - Intronic
1146757720 17:35448335-35448357 AAACCGCTGCTCGCTGGGCAGGG + Intronic
1147466968 17:40617725-40617747 GAAGCCTTGAGTGCTGGGCTGGG + Intergenic
1148158251 17:45435677-45435699 AAGAGCCTGACTGCTGGGCTTGG + Intergenic
1148885606 17:50770102-50770124 AAATGCCTGATCGCAGGGCTGGG - Intergenic
1149887194 17:60351716-60351738 AAATGCCTGACAGCTGGGCTTGG - Intronic
1149907004 17:60535743-60535765 AAACATCTGGTAGCTGGGCTGGG - Intergenic
1158498217 18:57975752-57975774 AAAAGCCTGATTGCAGGACTGGG - Intergenic
1160669965 19:357030-357052 AAACTCATCATTGCTGGGCTGGG - Intergenic
1160986308 19:1840599-1840621 AAACACAGGATTACTGGGCTGGG - Intronic
1161480358 19:4507279-4507301 AAACCTGTGACTGCTGGGCACGG + Intronic
1161792511 19:6368780-6368802 TCACCCCTTGTTGCTGGGCTTGG + Exonic
1162142904 19:8595509-8595531 AGACCCCTGATTTGAGGGCTGGG - Intronic
1162629849 19:11918743-11918765 AAAACCCTAATTGCTGAGCATGG - Intergenic
1162634949 19:11960582-11960604 AAACCGCTCATTGCTGAGCGTGG - Intronic
1163088945 19:15004944-15004966 GAACCATTCATTGCTGGGCTGGG - Intronic
1165886234 19:39080945-39080967 AAACCACTGATGGCTGGGCACGG + Intergenic
1168525513 19:57085557-57085579 AAGTGGCTGATTGCTGGGCTGGG - Intergenic
925966940 2:9075122-9075144 ACACCCCTGATTACAGGGGTTGG + Intergenic
926707516 2:15847157-15847179 AAACCCTGGTCTGCTGGGCTAGG + Intergenic
926841656 2:17087931-17087953 AAATCACTGATCACTGGGCTGGG + Intergenic
927793027 2:26025719-26025741 AGACAGCTGATTGCAGGGCTAGG - Intergenic
927985265 2:27405722-27405744 AACACCCTGGTTGCTGGGCATGG + Intronic
928036548 2:27829655-27829677 AAACCACTGAGGGCTGGGCGTGG - Intronic
928559315 2:32462659-32462681 AAACTCATCATTGCTGGGCTGGG + Intronic
928906826 2:36377104-36377126 AAACACCTGTGTGCAGGGCTGGG - Intronic
929426536 2:41850069-41850091 AAACACATGAATGCTGAGCTAGG - Intergenic
930056969 2:47259613-47259635 AAGCCCCAGATTTCTGGGCCTGG - Intergenic
930641827 2:53860607-53860629 ATATCCATGATTCCTGGGCTTGG - Intergenic
931651920 2:64476388-64476410 AACACCTTGGTTGCTGGGCTTGG + Intergenic
931808784 2:65834144-65834166 ATACCCCTTATTGCTGTGCCAGG - Intergenic
932553416 2:72796111-72796133 AAATACCTGAAGGCTGGGCTTGG - Intronic
934028483 2:88019797-88019819 AAACCTCTGCTGGCTGGACTAGG - Intergenic
934108477 2:88718428-88718450 AAATCCATAATGGCTGGGCTCGG - Intronic
938070378 2:128305291-128305313 AAACCCCTCCTTGCTGGGCCTGG + Intronic
938709913 2:133967366-133967388 AAACACCTGCTGGCTGGGCATGG - Intergenic
940909249 2:159195917-159195939 AAACCCCAGAGTACTGGGCCTGG - Intronic
942938809 2:181591910-181591932 AAATGGCTGATTCCTGGGCTGGG + Intronic
943772765 2:191736527-191736549 CAACCTCTGAGTTCTGGGCTTGG + Intergenic
1169189012 20:3645474-3645496 CAGCCACTGTTTGCTGGGCTGGG - Intronic
1170119876 20:12900312-12900334 AAGCCCCTGATACCTGGGCATGG + Intergenic
1172839056 20:37891074-37891096 TGACCCCAGATTGCTGGGCCTGG - Intergenic
1173576758 20:44116988-44117010 AAACCCTTCATGGCTGGGCGCGG + Intronic
1173689693 20:44950847-44950869 AATCCCTAGCTTGCTGGGCTGGG + Intronic
1173896934 20:46558357-46558379 AAGCCCCAAATTCCTGGGCTGGG - Exonic
1178968383 21:37146671-37146693 AGACCAGTGATTGCTGGGCCTGG + Intronic
1179830090 21:43991316-43991338 TCACCCCTTTTTGCTGGGCTGGG + Intergenic
1180728660 22:17964821-17964843 AAACCCCGAATTGCTCAGCTGGG + Intronic
949501952 3:4688451-4688473 AAAGCACTGATTGCTGGGCCAGG - Intronic
951977819 3:28533170-28533192 AAGCCCTTGCTTGCTGTGCTAGG - Intronic
952085592 3:29816584-29816606 GAACCTTTGATTTCTGGGCTTGG - Intronic
954040881 3:47886591-47886613 AATTGCCTGATAGCTGGGCTTGG - Intronic
954224946 3:49175320-49175342 AACACCCTGAGTGCTGGGCCAGG - Intronic
960202256 3:114851000-114851022 ACAGCCCTGGTTTCTGGGCTTGG - Intronic
961034832 3:123635014-123635036 ACTGCCCTGATGGCTGGGCTGGG + Intronic
962536302 3:136332129-136332151 AAACTGCTGATTCCTGGGCTGGG - Intronic
965802782 3:172511854-172511876 CATCCCTTGATTGCTGTGCTGGG - Intronic
966410639 3:179642848-179642870 AGACCTCTGCTTGCTGAGCTTGG - Intergenic
966571919 3:181453550-181453572 AAACCCCTGAGAGTAGGGCTTGG + Intergenic
966700800 3:182848048-182848070 AAAGCCCTGAATGCTGGAATCGG - Intronic
968098133 3:195946593-195946615 ACACCCCTGGTTACTGGGTTAGG + Intergenic
968238541 3:197053793-197053815 AATCTGCTGATTGCTGGGCAAGG + Intronic
968634679 4:1671900-1671922 AAACGGCTGATTTCAGGGCTGGG + Intronic
969674226 4:8606325-8606347 AAACCCCTGCTTCAGGGGCTGGG + Intronic
971510642 4:27418942-27418964 AAACCCGGGAATGCTGGGGTTGG - Intergenic
973141903 4:46780224-46780246 AAACCCCTGCTGGCCGGGCACGG + Intronic
973232768 4:47861154-47861176 AAAACACAGATTGCTGGGCCGGG - Intronic
976858754 4:89637333-89637355 AAAACCCGGATTCCTGGGCTGGG - Intergenic
978091117 4:104716401-104716423 AAACCCCAGGTTTCTGGGTTGGG + Intergenic
979058125 4:116019654-116019676 ATACCCCCGCTTCCTGGGCTAGG - Intergenic
979781392 4:124654729-124654751 TAACCACTGTTTGCTGGGCACGG - Intergenic
981153911 4:141412038-141412060 AAATTCCTGATTCCAGGGCTGGG - Intergenic
983575274 4:169254795-169254817 CAACCCCTGCTTGCTGTGCTTGG - Intronic
984896495 4:184546141-184546163 ACTCCCCTGAATGCAGGGCTGGG + Intergenic
985505827 5:279870-279892 ACACCCGTGATTACTGGGTTAGG - Intronic
985616791 5:927421-927443 AAGCCCCAGGTCGCTGGGCTAGG - Intergenic
985742370 5:1626055-1626077 ACACCCGTGATTACTGGGTTAGG + Intergenic
986343500 5:6812988-6813010 AAACACCTGAGTCCAGGGCTTGG - Intergenic
989051299 5:37322720-37322742 AAATCCATTATTGCTGGGCATGG + Intronic
991041718 5:62182951-62182973 AGAGTCCTGATTGCTGGGCTTGG - Intergenic
992381124 5:76238921-76238943 AGTCCTCTGATTGCTTGGCTGGG + Intronic
995551729 5:113288273-113288295 AAAGCCCTGCCTGCAGGGCTGGG + Intronic
997471326 5:134118741-134118763 AAAACCCTGGTTACTGGTCTAGG - Intronic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998989921 5:147804255-147804277 TGACCTCTGATTTCTGGGCTTGG - Intergenic
999323018 5:150626291-150626313 AAAACCCTGTTTGCTGGGTGGGG + Intronic
1003304061 6:4910529-4910551 AAGCCAGTGCTTGCTGGGCTGGG + Intronic
1003459542 6:6317694-6317716 AAACACCTATTTGCTGGGATAGG - Intronic
1006030873 6:31175715-31175737 AAACACCTGAAAGCTGGGGTGGG - Intronic
1006742567 6:36320019-36320041 AACCCCAGGATTGCTGGGCGGGG + Intronic
1007261658 6:40568296-40568318 AAACCCCTGATCTGTGGGCCTGG + Intronic
1007496495 6:42263398-42263420 GAACCCCTGAGAGCTGGGCTTGG + Exonic
1007822378 6:44570168-44570190 CAAGCCCTGGCTGCTGGGCTGGG + Intergenic
1009303030 6:62051554-62051576 AAACCTCTGAAGGCTGGCCTTGG + Intronic
1009419774 6:63452402-63452424 AAACCCCAGGTTGCTGGGTGTGG - Intergenic
1011222817 6:85074613-85074635 ACACACCTGGCTGCTGGGCTGGG + Intergenic
1014849479 6:126323817-126323839 AAATCCCTGCAGGCTGGGCTTGG + Intergenic
1016068968 6:139714531-139714553 ACATCCTTGATTACTGGGCTGGG + Intergenic
1016199808 6:141394309-141394331 ACACTCCTGATGGCTGGGCTTGG + Intergenic
1016390791 6:143572841-143572863 AAACCACTGTTGGCTGGGCACGG - Intronic
1018706406 6:166466577-166466599 AGAACCAGGATTGCTGGGCTGGG - Intronic
1019434055 7:1012688-1012710 AAACTCCTGCTTTCTGTGCTGGG + Intronic
1023437120 7:40150371-40150393 AAACCTCTGCTCGCTGGGCCGGG + Intronic
1023905484 7:44518871-44518893 AGACCCCGAATTGCTGGGCTGGG - Intronic
1024272019 7:47649809-47649831 CAACCCCTAATTCCTGGCCTGGG + Intergenic
1025161290 7:56663339-56663361 CATCACCTGAATGCTGGGCTGGG - Intergenic
1025191472 7:56898873-56898895 AAACCCCTCCTGGCTGGGTTGGG - Intergenic
1026023211 7:66726660-66726682 AAACCTCTGCTTTTTGGGCTGGG - Intronic
1026417197 7:70194659-70194681 AAACCCCTGACTGCTTGGGATGG - Intronic
1029341242 7:99946430-99946452 GAAGGCCTGATTGCTGGGGTGGG - Intergenic
1029557945 7:101283306-101283328 AAAGATCTGATTGCTGGGCGCGG + Intergenic
1029668032 7:102008408-102008430 AAATCCCTCTTTGCTGGGCTGGG - Intronic
1030691328 7:112537837-112537859 AAAGCTCTGATTGTTTGGCTTGG + Intergenic
1031713699 7:125080715-125080737 AAACCCATATTTTCTGGGCTTGG - Intergenic
1032507880 7:132449732-132449754 AAGCCCAGGTTTGCTGGGCTGGG + Intronic
1032727004 7:134599439-134599461 CAAGCTCTGATTGCTGGGCTGGG + Intergenic
1034269018 7:149794719-149794741 AGAGGCCTGAGTGCTGGGCTGGG + Intergenic
1036732892 8:11281879-11281901 AAACGCCTTTTTGTTGGGCTAGG - Intergenic
1039911636 8:41831355-41831377 AAACCCATGTTTGCCGGGCATGG + Intronic
1040026540 8:42786872-42786894 AAGCCCCTCATTGCTGGCCCAGG - Intronic
1048512314 8:135073790-135073812 TAAGCCCAGATTGGTGGGCTGGG - Intergenic
1048642095 8:136375129-136375151 AAACCCATGATTGATGTCCTTGG + Intergenic
1050627942 9:7525963-7525985 AAATGGCTGATTTCTGGGCTGGG - Intergenic
1052835461 9:33246743-33246765 CAACCCCTGCTTGCTTGGGTGGG + Intronic
1053097609 9:35342047-35342069 AAACCCCTCAGTGAAGGGCTTGG - Intronic
1055513546 9:77016841-77016863 AGACCCCAGCTTCCTGGGCTGGG + Intergenic
1056458149 9:86783254-86783276 AATCCCCTAATTTCTGGGTTGGG + Intergenic
1057587528 9:96342960-96342982 AACCCCGTCATTGCTGGCCTGGG - Intronic
1059979173 9:119750916-119750938 AAACCACTGGATGCTGGGCCGGG + Intergenic
1062183317 9:135202768-135202790 AAGCCCCTGACTGCTGGTCTGGG + Intergenic
1062524160 9:136971613-136971635 GACCCCCTGAGGGCTGGGCTGGG + Exonic
1062600896 9:137318221-137318243 GGACCCCTGTCTGCTGGGCTGGG + Intronic
1185948215 X:4401538-4401560 AACCACCTGACTGCTGGGATGGG + Intergenic
1186388139 X:9130881-9130903 AAAGCCCTGAGGGCTGGACTTGG - Intronic
1186540418 X:10394262-10394284 AAACCCCTGACTCCAAGGCTGGG + Intergenic
1187993929 X:24905399-24905421 AAATCACAGATTGCTGGGGTGGG + Intronic
1188860023 X:35244772-35244794 ACACTCCTGACTGCTGGGCCTGG - Intergenic
1189207925 X:39257634-39257656 AACCCCATGAATCCTGGGCTTGG + Intergenic
1190067907 X:47255078-47255100 AAACCCCTGAATGAAGGGTTTGG - Intergenic
1190221112 X:48512740-48512762 AACCCCCTCATTGCTGGGCAGGG - Intronic
1190290392 X:48988596-48988618 AAACCCCTGGTGGTTGGGATTGG - Intronic
1190293198 X:49006945-49006967 AAATAGCTGATTGCAGGGCTGGG + Intergenic
1190537752 X:51446560-51446582 ACATCCCTGATTGCAGGACTTGG - Intergenic
1193468904 X:81876159-81876181 AAACTCCTGATAGCTGGACCTGG - Intergenic
1193580385 X:83257254-83257276 CAAGTCCTGATTGCTGTGCTGGG - Intergenic
1195967071 X:110438442-110438464 AAAGCCCTGAGTGCTGGGGTGGG - Intronic
1199964376 X:152807442-152807464 AAACTCCTTTTTGCTGTGCTGGG + Intergenic