ID: 1062808871

View in Genome Browser
Species Human (GRCh38)
Location 10:447269-447291
Sequence TGTGATCCTGAATATCGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 3, 2: 8, 3: 12, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062808871_1062808880 21 Left 1062808871 10:447269-447291 CCCCGTCGATATTCAGGATCACA 0: 1
1: 3
2: 8
3: 12
4: 34
Right 1062808880 10:447313-447335 ACTCACCCCTGTCGATATTCAGG No data
1062808871_1062808877 -6 Left 1062808871 10:447269-447291 CCCCGTCGATATTCAGGATCACA 0: 1
1: 3
2: 8
3: 12
4: 34
Right 1062808877 10:447286-447308 ATCACACACAGTGGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062808871 Original CRISPR TGTGATCCTGAATATCGACG GGG (reversed) Intronic
911986454 1:104631187-104631209 TGTGTTCCTTAATATAGACCTGG - Intergenic
922499954 1:226089583-226089605 TGGGTTCCTGAATAACCACGTGG + Intergenic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808948 10:447667-447689 TGTGATCCTGAATATCAATGGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809064 10:448316-448338 TGTGATCCTGAATATCAATGGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809204 10:449118-449140 TATGATCCTGAGTATCAACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064872427 10:19953290-19953312 TGTGATTCAGAATAGGGACGTGG + Intronic
1076150401 10:128157679-128157701 TGTGGACCTTAATATCAACGTGG - Intergenic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1101272215 12:103159685-103159707 TGTGAACCTGAGTATTGAAGGGG - Intronic
1115004893 14:28469666-28469688 TGTGTCCCTGAATACCCACGTGG - Intergenic
1132474075 16:123934-123956 TGTGATCCTGTTTCTCAACGTGG - Intronic
1133991104 16:10708241-10708263 TGTGGTTCTGAATATCCAAGAGG - Intergenic
1136413669 16:30091276-30091298 TGTGATCCTGGATCTGGAAGGGG - Intronic
1156179925 18:34591177-34591199 TGTGATTCTAAATATTAACGTGG - Intronic
1161788083 19:6340641-6340663 TGAGATCCTGAATCTTGGCGAGG + Intergenic
1165825179 19:38701665-38701687 TGTGGTCCTGGTTATCTACGTGG - Intronic
1166906475 19:46113440-46113462 CGTAATCCTGGATATCTACGTGG - Intergenic
1167311047 19:48738272-48738294 TTTGATACTGAATATTGACAAGG - Intronic
945493235 2:210480100-210480122 TGTGATCCTGAATGGCCACATGG - Intronic
1170423444 20:16215083-16215105 TGTGATCCTGAAAATCCCTGTGG - Intergenic
1173470453 20:43319638-43319660 TGGGATCCTGAACATCCATGTGG + Intergenic
1177890743 21:26800995-26801017 TGTGATCCTGCAGACAGACGAGG - Intergenic
1178176346 21:30104058-30104080 TGTGATACAGAAGACCGACGTGG + Intergenic
1182636084 22:31728118-31728140 TGGGCTCCTGAATATGGATGAGG + Intronic
962364517 3:134769197-134769219 GGTGATTCTGAATATGGTCGGGG + Intronic
963309565 3:143694366-143694388 TCTGAACCTGAATATCCATGAGG + Intronic
965010335 3:163079978-163080000 CGTGATCCTGAATAACTACTGGG + Intergenic
970888026 4:21008941-21008963 TGTGATCCTGAATTTGGGGGAGG - Intronic
985422600 4:189799673-189799695 TGGGATCCTGAATAACCAGGTGG - Intergenic
988066430 5:26232249-26232271 TGTGATGCTGAAGAACCACGTGG - Intergenic
995042245 5:107602270-107602292 TGTAATTCTGAATATTGATGAGG + Intronic
997910841 5:137871484-137871506 TCTAATCCTGAATATCCACTTGG + Intronic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1032786755 7:135207173-135207195 TGTGATCCTGAACTTTGATGCGG - Exonic
1038576089 8:28704132-28704154 TGTGATCTTGAAAATAGAAGAGG + Intronic
1055230152 9:74053359-74053381 TGTAATCCTGAATATTTAAGGGG + Intergenic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic