ID: 1062808948

View in Genome Browser
Species Human (GRCh38)
Location 10:447667-447689
Sequence TGTGATCCTGAATATCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 2, 1: 1, 2: 1, 3: 16, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062808948_1062808957 21 Left 1062808948 10:447667-447689 CCCCATTGATATTCAGGATCACA 0: 2
1: 1
2: 1
3: 16
4: 157
Right 1062808957 10:447711-447733 GCTCACTCCCACTGATGCTCAGG No data
1062808948_1062808954 -6 Left 1062808948 10:447667-447689 CCCCATTGATATTCAGGATCACA 0: 2
1: 1
2: 1
3: 16
4: 157
Right 1062808954 10:447684-447706 ATCACACACAGTGGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062808948 Original CRISPR TGTGATCCTGAATATCAATG GGG (reversed) Intronic
900568279 1:3346002-3346024 TGTGAGCGTGCATATCAAAGGGG + Intronic
902170447 1:14606129-14606151 AGTGATCCTGGATGTCAAAGTGG - Intronic
904763271 1:32820551-32820573 TGAGATCGTGAACATAAATGTGG - Intronic
906896525 1:49779254-49779276 TGTGATCCTAAATGTCAAAATGG + Intronic
908878099 1:68700576-68700598 TGTGATCCTGATCATCAGTATGG + Intergenic
910387348 1:86699482-86699504 TGTCATCCTGAACAAAAATGGGG - Intergenic
910937849 1:92500649-92500671 TGTGATATTGAATATAATTGGGG - Intergenic
912687026 1:111775848-111775870 TGTGATACTGCATCTCACTGGGG - Exonic
913442872 1:118917609-118917631 TGTAAGCATGAATATCAAAGTGG + Intronic
924020972 1:239781892-239781914 TGTAATCCATAATATCAATATGG - Intronic
924642966 1:245851047-245851069 TGAAATCCTGAAAATCAATCGGG + Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808948 10:447667-447689 TGTGATCCTGAATATCAATGGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809064 10:448316-448338 TGTGATCCTGAATATCAATGGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809204 10:449118-449140 TATGATCCTGAGTATCAACAGGG - Intronic
1063492229 10:6475165-6475187 TCTGAACCTGAATCTGAATGAGG - Intronic
1067760565 10:49042462-49042484 TGTGATCCTGAATGCCTGTGTGG - Intronic
1070731168 10:78829293-78829315 TGAGAGGCTGAATTTCAATGAGG - Intergenic
1071301994 10:84262683-84262705 TGTGTGTCTGCATATCAATGTGG - Intergenic
1076150401 10:128157679-128157701 TGTGGACCTTAATATCAACGTGG - Intergenic
1081485774 11:43527280-43527302 TGTGTTCCTGAAGTTTAATGGGG + Intergenic
1087091700 11:94280401-94280423 TGTGATCCTGAAGGTCTGTGAGG + Intergenic
1087321631 11:96667597-96667619 TGTGATCCTAAATTGCAATTTGG - Intergenic
1091673457 12:2469111-2469133 TGTGATTCTGTATATCCTTGGGG - Intronic
1092856853 12:12681941-12681963 TGGGATCTTGAGTATCAGTGTGG - Intronic
1093708059 12:22297037-22297059 GGTGCTCCTGAATAGCACTGGGG + Intronic
1094476971 12:30848079-30848101 AAATATCCTGAATATCAATGCGG + Intergenic
1094706404 12:32918596-32918618 AGTGATTCTGAATATTAGTGAGG - Intergenic
1095497772 12:42803341-42803363 TGGGTTCCTGAATAACCATGTGG - Intergenic
1095568147 12:43650260-43650282 TGTAATCCTCAGTATCAAGGAGG - Intergenic
1098314569 12:69179907-69179929 TTTGCTCCTGGATATCAATAAGG + Intergenic
1099784328 12:87241089-87241111 TGTGATTCTGATTCTCCATGTGG - Intergenic
1100871299 12:98913322-98913344 TATGGTCCTGAATGTCAAGGAGG - Intronic
1106288470 13:28338737-28338759 TGTGATCCAGAACATAATTGAGG - Intronic
1106488302 13:30192012-30192034 TGTGACCTTGAATCTCAATTCGG + Intergenic
1107675321 13:42790374-42790396 AGTGATGCAGAATATCAAGGAGG + Exonic
1109118348 13:58419942-58419964 TATGATCCAGTATATAAATGTGG - Intergenic
1109529957 13:63629705-63629727 TCTGATTCTGGAAATCAATGAGG + Intergenic
1110682784 13:78336111-78336133 AGTGGTCCTGAATCTTAATGAGG - Intergenic
1113118237 13:106897026-106897048 TGTGATTCTGAAAATTTATGAGG - Intergenic
1115230554 14:31155714-31155736 TGTGCTCCTGGATTTCATTGTGG + Intronic
1116566810 14:46456744-46456766 TGATATCATGTATATCAATGTGG - Intergenic
1116699205 14:48217141-48217163 TTTGATACTGAATATCAAGCAGG + Intergenic
1118901159 14:69987099-69987121 TGTGATTCTGAGGCTCAATGTGG - Intronic
1120672974 14:87385958-87385980 TGTGATCATGAGTATCATGGGGG + Intergenic
1121569798 14:94939188-94939210 TGTGTCCATGAATATCTATGGGG - Intergenic
1123804539 15:23857706-23857728 TGTGATACTGCATATCATAGAGG - Intergenic
1125405477 15:39348959-39348981 TGTGGACATGAACATCAATGGGG + Intergenic
1126428102 15:48551121-48551143 TGGAATGCTGATTATCAATGTGG + Intronic
1126958726 15:53965403-53965425 TCTAATACTGAATATCAATTTGG + Intergenic
1132474075 16:123934-123956 TGTGATCCTGTTTCTCAACGTGG - Intronic
1133052797 16:3127199-3127221 GGTGATCCTGAAATTCAAAGTGG - Intergenic
1133629192 16:7602971-7602993 TGTGCTCCTGAATGTCCATTGGG + Intronic
1133991104 16:10708241-10708263 TGTGGTTCTGAATATCCAAGAGG - Intergenic
1134175070 16:11999281-11999303 TGTGATCCTAAAATGCAATGAGG - Exonic
1137425251 16:48373942-48373964 TTTTCTCCTGAATATCCATGTGG + Intronic
1137434475 16:48444373-48444395 TGTCATCCTGCAAAACAATGAGG + Intronic
1138686894 16:58733932-58733954 TGGGATCCTGAGGATCACTGTGG + Intronic
1148827113 17:50401929-50401951 TGTGATTCTGCATCCCAATGAGG + Intergenic
1149442924 17:56690363-56690385 TGTGATACTTAATATAACTGAGG - Intergenic
1150542419 17:66116462-66116484 TTTGATCCTCAATATCACTTTGG + Intronic
1150645630 17:66976007-66976029 TCTGTTCCTGAGTATCAATCTGG - Intronic
1150988040 17:70221542-70221564 TCTGAACCGGAATCTCAATGGGG + Intergenic
1151064470 17:71134576-71134598 TTTGAACCTGAATATCCCTGAGG + Intergenic
1151070530 17:71205477-71205499 TGTGATCCTGTGGATGAATGAGG + Intergenic
1156179925 18:34591177-34591199 TGTGATTCTAAATATTAACGTGG - Intronic
1156385575 18:36601865-36601887 AGTGGTCCTGAATGTGAATGCGG + Intronic
1159289212 18:66395307-66395329 TGTTATTATGAATATTAATGTGG - Intergenic
1162870881 19:13585778-13585800 TGTGAACTTGAACATCTATGTGG - Intronic
1163189656 19:15667223-15667245 TGTGCTCCTGATTAGCAAAGTGG + Intergenic
925196291 2:1928858-1928880 TGTCTTCCTGAATATCAGTCCGG - Intronic
926342132 2:11912267-11912289 TGTGATCTTTAAAAGCAATGGGG - Intergenic
927954435 2:27198844-27198866 TGTCGTCATGAATATAAATGAGG + Intergenic
930097996 2:47581634-47581656 TTTGATCCTGAAGCTGAATGAGG - Intergenic
930388262 2:50725841-50725863 TATTATCTTGAATATTAATGAGG - Intronic
930863951 2:56104881-56104903 TGGGATGCTGAATATTAATTAGG - Intergenic
933263917 2:80160364-80160386 TGTTAACCTGTATATCAATTTGG + Intronic
937163694 2:119792659-119792681 TGTGAACCAGAATATCTATCGGG + Intronic
939926621 2:148182817-148182839 TGTGAATGTGAATGTCAATGTGG - Intronic
940442581 2:153735692-153735714 TGGGATCTTAAATGTCAATGAGG - Intergenic
941167867 2:162102948-162102970 TTTGATCCTGACTGTCACTGGGG + Intergenic
943195389 2:184740295-184740317 TGTGACCATAAATATCAATTGGG - Intronic
943605053 2:189967238-189967260 TGGGTTCCTGGATAGCAATGTGG + Intronic
946470814 2:219959130-219959152 TGTCATCCTCATTTTCAATGAGG - Intergenic
947358104 2:229317981-229318003 TGTGAACCTGGCTTTCAATGTGG - Intergenic
948589375 2:239039444-239039466 TGTGAGCCTGAAGGTCAGTGGGG - Intergenic
948714721 2:239853543-239853565 TTTGGTCCTGAAAATTAATGTGG + Intergenic
1170295430 20:14819650-14819672 TCTGATCCCTAAAATCAATGAGG - Intronic
1170423444 20:16215083-16215105 TGTGATCCTGAAAATCCCTGTGG - Intergenic
1172040296 20:32040211-32040233 TCTGAGCCTGAATCTCAAAGAGG - Intergenic
1173470453 20:43319638-43319660 TGGGATCCTGAACATCCATGTGG + Intergenic
1175527845 20:59647807-59647829 TGTGCTTGTGAATCTCAATGAGG + Intronic
1176900121 21:14430897-14430919 AGTTATCCTCAATATCCATGGGG + Intergenic
1177522930 21:22253495-22253517 TGTGATGCTGGATATCAGTGAGG + Intergenic
1182636084 22:31728118-31728140 TGGGCTCCTGAATATGGATGAGG + Intronic
951528558 3:23677664-23677686 AGTGTTCCAGAATATAAATGAGG - Intergenic
953320349 3:41965729-41965751 TCTGATTCTGTATCTCAATGGGG + Intergenic
956151054 3:66242857-66242879 TGTGATCCAAAATATCATTATGG - Intronic
956607280 3:71085473-71085495 TGGGATACTAAATATTAATGGGG - Intronic
957566716 3:81893509-81893531 TGTAACCCTGAACATCTATGTGG - Intergenic
959326666 3:104945726-104945748 TGTGGTCCGCAATTTCAATGAGG - Intergenic
962779951 3:138703912-138703934 TGATATCCTGAATAAGAATGGGG + Intronic
963309565 3:143694366-143694388 TCTGAACCTGAATATCCATGAGG + Intronic
964528523 3:157642216-157642238 GATGCTCATGAATATCAATGTGG + Intronic
964814551 3:160703025-160703047 TGTTTTCCTGAATACCAGTGAGG + Intergenic
965203516 3:165692087-165692109 TGTGATCTTGAATTCCTATGTGG - Intergenic
967546642 3:190737775-190737797 TGGGAACCTGAGTTTCAATGGGG - Intergenic
969220120 4:5753725-5753747 TGTGAGCCAGAATTTCAGTGGGG - Intronic
970846227 4:20541304-20541326 TGTGATTCTGAGTAAGAATGGGG + Intronic
972131157 4:35835129-35835151 TGTGTTCCTGAAGAACAATGTGG + Intergenic
973113094 4:46419651-46419673 TGTAATCCTGCATCTCCATGTGG + Intronic
974841647 4:67306218-67306240 TGGGTTCCTGAATATCCTTGTGG + Intergenic
976307643 4:83576848-83576870 TGATATCCTAAATATCCATGGGG + Intronic
977624036 4:99170738-99170760 TGTTAACCTGAATATCATTCAGG + Intergenic
980501456 4:133659714-133659736 TGTGCTCTTGAATAACAATGAGG + Intergenic
980861922 4:138509267-138509289 TGGGATCCAGCATATAAATGCGG + Intergenic
981239349 4:142457382-142457404 TGTGATCAGGAATTTCAATATGG + Intronic
981833062 4:149024031-149024053 TTTGATGCTGACTATCAAGGGGG + Intergenic
982661713 4:158215117-158215139 TGTGCTCAGGAATATCTATGAGG - Intronic
984604165 4:181765425-181765447 AGTAATCATTAATATCAATGTGG - Intergenic
985422600 4:189799673-189799695 TGGGATCCTGAATAACCAGGTGG - Intergenic
993448494 5:88044454-88044476 TGTCATCCTGATTAAGAATGTGG + Intergenic
994732430 5:103508214-103508236 TGCGACCCTGGATAACAATGAGG - Intergenic
995042245 5:107602270-107602292 TGTAATTCTGAATATTGATGAGG + Intronic
995044740 5:107633165-107633187 TGTTATCCTTAATACCAATGGGG + Intronic
995999796 5:118345910-118345932 TGTGATCATGAAAATTACTGTGG - Intergenic
996921037 5:128768020-128768042 TGTGATCACGAATTTCAAAGAGG - Intronic
997104865 5:131006793-131006815 TGTTATCTTGAATTTCACTGAGG - Intergenic
998409930 5:141902006-141902028 TGTGACTGTGAATGTCAATGCGG + Intergenic
1002659122 5:180778484-180778506 TATGAGCCTGAAAATAAATGCGG - Intergenic
1005466041 6:26114501-26114523 TATGATCCTGAATAGCAATTTGG + Intergenic
1006288966 6:33119654-33119676 GAACATCCTGAATATCAATGTGG - Intergenic
1007837611 6:44686115-44686137 TTTGATCCTGAACATGAAAGAGG + Intergenic
1011480667 6:87790564-87790586 TGTGGTTCTGAATAAAAATGAGG + Intergenic
1011622764 6:89258059-89258081 TGTGGTTCTGAGTAGCAATGTGG - Intronic
1019909079 7:4087814-4087836 TGTGAGCCTGAATTTCCATCTGG + Intronic
1020969324 7:14914525-14914547 TGTGATCATTTATGTCAATGTGG - Intronic
1021317943 7:19173426-19173448 TATAATCCTGAGTAACAATGTGG - Intergenic
1021928831 7:25559522-25559544 TGGGATGCTAATTATCAATGGGG - Intergenic
1023492899 7:40763228-40763250 AGTGAGCCTGAATATGAATTAGG + Intronic
1025009260 7:55382779-55382801 TGTTATCCTGAAGAGCAATTGGG + Intronic
1028939354 7:96503644-96503666 TCTGATGCTGAAAATAAATGAGG - Intronic
1032053445 7:128664841-128664863 TGTCCTCATGAATCTCAATGAGG + Intergenic
1032786755 7:135207173-135207195 TGTGATCCTGAACTTTGATGCGG - Exonic
1032929850 7:136653904-136653926 TGAGATCCTGAATGTGACTGTGG + Intergenic
1035195233 7:157213585-157213607 TGTGATTCTGAAAGTGAATGTGG + Intronic
1037111635 8:15169508-15169530 TGTGAGCCTGAATTTTCATGGGG + Intronic
1044393515 8:91681510-91681532 AGGAATCCTGACTATCAATGAGG + Intergenic
1046088173 8:109464851-109464873 TGTGATGGTGAATAACTATGAGG + Exonic
1048650084 8:136466386-136466408 TGTTATAATAAATATCAATGGGG - Intergenic
1048736920 8:137512502-137512524 TGTAATCCTGACTACCAATAAGG - Intergenic
1051682562 9:19622597-19622619 TGTGATCATTAAAATGAATGAGG + Intronic
1053020501 9:34690886-34690908 TGTGCCCCTGAATCCCAATGCGG - Intronic
1053563846 9:39226374-39226396 TGGGATGCTGAAGATCAAGGTGG + Intronic
1054133302 9:61392696-61392718 TGGGATGCTGAAGATCAAGGTGG - Intergenic
1055169301 9:73235683-73235705 AGTCATCCTCAGTATCAATGGGG - Intergenic
1055230152 9:74053359-74053381 TGTAATCCTGAATATTTAAGGGG + Intergenic
1058398309 9:104582147-104582169 TGTTATCCTGAGAATTAATGAGG - Intergenic
1060752638 9:126183623-126183645 TCTGCTCCTGTATATGAATGAGG - Intergenic
1186268076 X:7853219-7853241 TGTGGTCCTGTATATCAGTTGGG + Intergenic
1199465959 X:148137499-148137521 TGTGATCCTGTATATTAGTAAGG - Intergenic
1200888255 Y:8294335-8294357 TTTGAACCTTCATATCAATGTGG - Intergenic