ID: 1062808966

View in Genome Browser
Species Human (GRCh38)
Location 10:447767-447789
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 3, 1: 9, 2: 5, 3: 7, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062808966_1062808975 21 Left 1062808966 10:447767-447789 CCCCGTCTATACTCAGGATCACA 0: 3
1: 9
2: 5
3: 7
4: 83
Right 1062808975 10:447811-447833 GCTCACTCCCGTCGATACTCAGG No data
1062808966_1062808972 -6 Left 1062808966 10:447767-447789 CCCCGTCTATACTCAGGATCACA 0: 3
1: 9
2: 5
3: 7
4: 83
Right 1062808972 10:447784-447806 ATCACACACAGTGGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062808966 Original CRISPR TGTGATCCTGAGTATAGACG GGG (reversed) Intronic
901771994 1:11535271-11535293 TGTGCTCCTGAGCAGAGCCGGGG + Intronic
902055516 1:13597613-13597635 TGCGATGCTGAGTCTAGATGGGG - Intronic
903188669 1:21644003-21644025 CATGATGCTGAGGATAGACGTGG + Intronic
904106224 1:28087176-28087198 TGTGATCTAGAGTATAGGCTTGG - Intronic
908554137 1:65240190-65240212 TGTGATGCTGAGGATTGACTGGG + Intergenic
908944491 1:69477441-69477463 TGTTATCCTGAGGATAGTCTTGG + Intergenic
911497563 1:98650185-98650207 TGTGATCCTGAGGCTGGACCAGG + Intergenic
911986454 1:104631187-104631209 TGTGTTCCTTAATATAGACCTGG - Intergenic
915528405 1:156489887-156489909 TGTGAACCTGAGGGTAGACTGGG - Intronic
917122596 1:171657229-171657251 TGTGTTCCCTGGTATAGACGGGG + Intergenic
923692740 1:236211843-236211865 GGTGTTCCTGAGTATAGACTAGG - Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808948 10:447667-447689 TGTGATCCTGAATATCAATGGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809064 10:448316-448338 TGTGATCCTGAATATCAATGGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809204 10:449118-449140 TATGATCCTGAGTATCAACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064156099 10:12904520-12904542 TGTGGTCCTAAGGATAGAGGAGG - Intronic
1070341378 10:75501498-75501520 TGTGGGCCTGTTTATAGACGTGG + Intronic
1073840631 10:107495228-107495250 TGTGTTTCTTAGTATAGACAGGG - Intergenic
1076703535 10:132287623-132287645 TGTGATTTTTAGTAGAGACGGGG + Intronic
1076814631 10:132908721-132908743 TGTGATCCTAAGCAGAGGCGTGG + Intronic
1077126006 11:937190-937212 TTGGATCTTGAGTAGAGACGGGG + Intronic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1083105015 11:60348931-60348953 TCTTCTCCTGAGTATAGAAGTGG - Intronic
1088424259 11:109684871-109684893 TATGTTCCTGAGTCTAGAAGGGG + Intergenic
1090956966 11:131521718-131521740 TGTGATCCTCAGTATGGGAGGGG - Intronic
1091146827 11:133287592-133287614 TGTGAACCAGTGTATAGAGGAGG + Intronic
1100567466 12:95811429-95811451 TGTTATCTTTAGTAGAGACGAGG - Intronic
1101272215 12:103159685-103159707 TGTGAACCTGAGTATTGAAGGGG - Intronic
1106895207 13:34292703-34292725 TGTGATGCTGTGTATAGCTGTGG - Intergenic
1108565983 13:51697834-51697856 TGTGTTTCTGTGTATACACGGGG + Intronic
1108736085 13:53284479-53284501 TGTGTTCTTTAGTAGAGACGGGG + Intergenic
1109393283 13:61721243-61721265 TGTGTTCTTTAGTAGAGACGGGG + Intergenic
1110000353 13:70190395-70190417 TGTGATACTAAGTAGTGACGTGG + Intergenic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1112686879 13:101839318-101839340 TGTGATCCTGAGAAAAGTCTTGG + Intronic
1115636319 14:35293047-35293069 TGTGAGCTTCAGTATAGAAGAGG - Intronic
1127451904 15:59124660-59124682 TGTGATCATGATTGTAGCCGTGG + Intronic
1132364788 15:101249685-101249707 TGTACTCTTGAGTAGAGACGGGG + Intronic
1133636420 16:7670202-7670224 TTGGATCCTTAGTAGAGACGGGG + Intronic
1138912011 16:61412339-61412361 TTTGATGATGAGTATAGATGGGG + Intergenic
1160965930 19:1746900-1746922 TGAGCTCCTGAGTAGAAACGCGG - Intergenic
1163033440 19:14558864-14558886 GGGGATCCTGAGCACAGACGGGG - Intronic
1164189002 19:22898375-22898397 TGTGTTTCTTAGTAGAGACGGGG + Intergenic
1164658878 19:29944988-29945010 TGACATCCTGAGTGTAGAAGGGG + Intronic
1168209140 19:54876743-54876765 TGTGTTTTTTAGTATAGACGAGG - Intronic
1168560157 19:57375477-57375499 TGTTATTCTTAGTAGAGACGGGG - Intronic
938754469 2:134367105-134367127 TGTGATCAGGAGCATAGACTTGG + Intronic
944199879 2:197095254-197095276 TGTGATCCTCAGTACAAACATGG - Intronic
944942169 2:204640468-204640490 TGTGACCCTGGGTAAAGACATGG - Intronic
946281683 2:218670519-218670541 TGTGATTTTTAGTAGAGACGGGG - Intronic
947084823 2:226438909-226438931 TGTGAGCCTGAGTTTAGGTGAGG - Intergenic
947818892 2:233057264-233057286 TGTGATCCTGGGTCCAGACTGGG - Intergenic
948465008 2:238148106-238148128 GGGGCTCCTGAGGATAGACGGGG + Intronic
1177890743 21:26800995-26801017 TGTGATCCTGCAGACAGACGAGG - Intergenic
1182775036 22:32824783-32824805 TTTGATACTGAGTAAAGACATGG + Intronic
1182948407 22:34347609-34347631 TGTGATTTTTAGTAGAGACGGGG + Intergenic
1183651141 22:39153625-39153647 TGTGGTCCAGAGAAAAGACGGGG - Intergenic
957466857 3:80604467-80604489 AATGATCCTGAGTATAAAAGGGG + Intergenic
959079701 3:101787048-101787070 AGTGATTCTCAGTAGAGACGGGG - Intronic
964328174 3:155571339-155571361 AGTGATTCTGGGTATAGGCGGGG - Intronic
970948870 4:21728679-21728701 TGTGATCCAGAGTGAAGAAGAGG - Intronic
978336923 4:107679120-107679142 TGTGCTCCTGAGTCTTGAGGTGG - Intronic
983800479 4:171923318-171923340 GGTGTTGCTGACTATAGACGAGG + Intronic
987348227 5:16997669-16997691 TGTATTCCTTAGTAGAGACGGGG - Intergenic
992771123 5:80049431-80049453 TGTTATCCTTAGTAGAGATGGGG + Intronic
993419019 5:87676589-87676611 TGTGAGCCTGAGTAGAAACTGGG + Intergenic
996375690 5:122804539-122804561 TTGTATCCTTAGTATAGACGGGG + Intronic
998884944 5:146684484-146684506 TGTGATCCTGATTAGATACCTGG + Intronic
998962802 5:147506931-147506953 TTTGAAGCTGAGTATAGACATGG + Intronic
1001813727 5:174650279-174650301 TGTAATTCTTAGTAGAGACGGGG + Intergenic
1005920059 6:30393326-30393348 TGTGATCCTTTGTACAGACAGGG + Intergenic
1029099309 7:98115240-98115262 TGTGTTTTTTAGTATAGACGGGG - Intronic
1032298400 7:130663911-130663933 TGTTATCTTTAGTAGAGACGGGG + Intronic
1033160970 7:138996389-138996411 TATGATTCTTAGTAGAGACGAGG - Intergenic
1037875694 8:22546693-22546715 TGTGATCCTAATAATAGACATGG + Intronic
1038576089 8:28704132-28704154 TGTGATCTTGAAAATAGAAGAGG + Intronic
1041445997 8:57951468-57951490 TGTTATACTGAGAATAGACAGGG - Intergenic
1047986697 8:130242751-130242773 TGTGATCATGAGTAGAGTTGTGG + Intronic
1053286803 9:36855016-36855038 TGTGATCCTCTGTAAAGAAGAGG + Intronic
1059380796 9:113922142-113922164 TGTGATCCTGGGGATAAACCAGG + Intronic
1060898662 9:127238159-127238181 TGTTATCTTTAGTAGAGACGGGG + Intronic
1061551376 9:131336728-131336750 TGTGATCCTGTTTACAGAGGAGG - Intergenic
1186705384 X:12135220-12135242 TGGGATCCTGAGTACATATGTGG - Intergenic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic
1198548135 X:137715649-137715671 TGTGATTTTTAGTAGAGACGGGG - Intergenic
1201439832 Y:13995524-13995546 TGTAATCATGAGTATAGACTAGG + Intergenic
1201444739 Y:14047184-14047206 TGTAATCATGAGTATAGACTAGG - Intergenic