ID: 1062808992

View in Genome Browser
Species Human (GRCh38)
Location 10:447917-447939
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 3, 1: 7, 2: 8, 3: 17, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062808992_1062809000 21 Left 1062808992 10:447917-447939 CCCTGTCTATACTCAGGATCACA 0: 3
1: 7
2: 8
3: 17
4: 148
Right 1062809000 10:447961-447983 AATCACCCCCGTTGATATTCAGG No data
1062808992_1062808997 -6 Left 1062808992 10:447917-447939 CCCTGTCTATACTCAGGATCACA 0: 3
1: 7
2: 8
3: 17
4: 148
Right 1062808997 10:447934-447956 ATCACACACAGTGGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062808992 Original CRISPR TGTGATCCTGAGTATAGACA GGG (reversed) Intronic
904106224 1:28087176-28087198 TGTGATCTAGAGTATAGGCTTGG - Intronic
908554137 1:65240190-65240212 TGTGATGCTGAGGATTGACTGGG + Intergenic
908944491 1:69477441-69477463 TGTTATCCTGAGGATAGTCTTGG + Intergenic
909339106 1:74511731-74511753 TGTGAGCCTGAGAAGAGTCAAGG + Intronic
910680977 1:89864113-89864135 TTTGATCCTCACTATTGACATGG - Intronic
911497563 1:98650185-98650207 TGTGATCCTGAGGCTGGACCAGG + Intergenic
911986454 1:104631187-104631209 TGTGTTCCTTAATATAGACCTGG - Intergenic
913181610 1:116327879-116327901 TGAGACCATGACTATAGACAAGG - Intergenic
915528405 1:156489887-156489909 TGTGAACCTGAGGGTAGACTGGG - Intronic
920640930 1:207751703-207751725 AGAGATCCAGAGTCTAGACAGGG - Intergenic
923692740 1:236211843-236211865 GGTGTTCCTGAGTATAGACTAGG - Intronic
924208771 1:241743349-241743371 CGTGTCCCTGATTATAGACAGGG - Intronic
924596839 1:245453700-245453722 TGTAATCCTGATAACAGACAAGG - Intronic
924868653 1:248015352-248015374 TGTCCTCCGGAGTATAGGCAAGG - Intronic
924871296 1:248048483-248048505 TGTCTTCTGGAGTATAGACAAGG - Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809204 10:449118-449140 TATGATCCTGAGTATCAACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064070378 10:12223792-12223814 TTTGCTTCTGAGTAAAGACAAGG + Intronic
1067023103 10:42819237-42819259 TGTGGCCCTGAGTAGAGGCATGG + Intronic
1068052352 10:51966801-51966823 AGTGATGCTGAGCATTGACAAGG - Intronic
1069444673 10:68462196-68462218 TGTGTTTGTGAGTAGAGACAGGG - Intronic
1069614128 10:69795808-69795830 TATGATTCTGTGTATTGACAGGG - Intergenic
1072309808 10:94143972-94143994 TGTGTCTCTGAGTATAAACAGGG - Intronic
1073840631 10:107495228-107495250 TGTGTTTCTTAGTATAGACAGGG - Intergenic
1074058693 10:109944798-109944820 TCTCATCCTGAGTATAAATAAGG + Intronic
1075351227 10:121726693-121726715 GGTGAGCCTGAGAGTAGACACGG + Intergenic
1075977016 10:126704943-126704965 TGCCATCCCGAGTCTAGACAAGG + Intergenic
1078785083 11:14482706-14482728 TGTTATTTTTAGTATAGACAGGG + Intronic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1085381662 11:76125356-76125378 TGTGTTCCTGTCTAGAGACAAGG - Intronic
1088565205 11:111164974-111164996 TGTGGCCATGAGTATATACAGGG - Intergenic
1088748731 11:112825912-112825934 TGTGATGCTTAGAAAAGACATGG - Intergenic
1088886592 11:114012512-114012534 AGTGAGCCTGAGTGTAGATAAGG + Intergenic
1092141464 12:6186549-6186571 TGAGATCCTGGGTATGGAAAAGG + Intergenic
1096021142 12:48326581-48326603 TGTGACCCTGAGGATTTACATGG - Intergenic
1096591028 12:52659389-52659411 AGGGATCCTGGGTATAGGCAGGG - Intergenic
1100829653 12:98506178-98506200 TGTTATCTTTAGTAGAGACAAGG + Intergenic
1101272215 12:103159685-103159707 TGTGAACCTGAGTATTGAAGGGG - Intronic
1105238604 13:18587619-18587641 TGTTATCTTTAGTAGAGACAGGG + Intergenic
1106781404 13:33062204-33062226 TGTGATTTTTAGTAGAGACAAGG - Intronic
1107271038 13:38616222-38616244 TGTGTTCCTGGGTGAAGACAAGG + Intergenic
1107337232 13:39368155-39368177 TGTAATTCTTAGTAGAGACAGGG - Intronic
1107586847 13:41858716-41858738 TGTGATCAACAGTATATACATGG + Intronic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1111420685 13:88006309-88006331 TGTTATCATGAGTATATAGATGG - Intergenic
1112412241 13:99174645-99174667 TGCGATCCTGAGCAAAAACATGG - Intergenic
1112686879 13:101839318-101839340 TGTGATCCTGAGAAAAGTCTTGG + Intronic
1115963291 14:38860056-38860078 TATGATCCTCTGAATAGACATGG - Intergenic
1116595097 14:46831774-46831796 TTTTATCTTGAGGATAGACAAGG - Intergenic
1117794159 14:59374664-59374686 TGTGATGCTGAGCAAGGACACGG + Intergenic
1122246548 14:100407304-100407326 TGTGAGCCTGAGAGTAAACAGGG - Intronic
1123968138 15:25479484-25479506 TGTGATGCTGAGCAGAAACAGGG + Intergenic
1124066079 15:26345287-26345309 GATTATCCTGATTATAGACATGG - Intergenic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1133762919 16:8814146-8814168 TGTGATTTTTAGTACAGACAGGG + Intronic
1134087018 16:11364268-11364290 TTTGATTTTTAGTATAGACAGGG - Intronic
1137865873 16:51895486-51895508 TGTGACCCAGAGGAAAGACAGGG - Intergenic
1203122113 16_KI270728v1_random:1547653-1547675 TGTGGCCCTGAGTAGAGGCATGG - Intergenic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1142732421 17:1869362-1869384 TGTGATTTTTAGTAGAGACAGGG - Intronic
1155908714 18:31484249-31484271 TGTGATCATGTGTACAGAAATGG - Intergenic
1156437599 18:37149620-37149642 TGTGTACCTGAATATAGAAAAGG + Intronic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1163810789 19:19430126-19430148 TGTGTTCTTGAGTACTGACATGG + Intronic
1164250909 19:23474297-23474319 TGTTGTTCTGAGTATAAACATGG - Intergenic
1164323663 19:24173427-24173449 TGTTACTCTGAGTATAAACATGG + Intergenic
1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG + Intronic
1167311047 19:48738272-48738294 TTTGATACTGAATATTGACAAGG - Intronic
925566853 2:5264525-5264547 TGTGATTCTGACGATAGAGAGGG + Intergenic
928281878 2:29953854-29953876 GGTGGTCATGAGTCTAGACATGG - Intergenic
928553270 2:32395733-32395755 GGTGTGCCAGAGTATAGACAGGG - Intronic
932781040 2:74558659-74558681 TGTGAACCTGAGCATGGATATGG + Exonic
934458991 2:94200622-94200644 TGTGGCCCTGAGTAGAGGCATGG - Intergenic
938754469 2:134367105-134367127 TGTGATCAGGAGCATAGACTTGG + Intronic
939836798 2:147139381-147139403 TGTGTTCCTCAGTGGAGACAGGG - Intergenic
940405300 2:153294262-153294284 TGGGAACCTGAGTATTGAGAAGG - Intergenic
940834975 2:158511019-158511041 TGTGAGCCTGAGTATGGTGAAGG + Intronic
944199879 2:197095254-197095276 TGTGATCCTCAGTACAAACATGG - Intronic
944942169 2:204640468-204640490 TGTGACCCTGGGTAAAGACATGG - Intronic
945169147 2:206978037-206978059 TGAGATCCTGATAATAGCCATGG + Intergenic
947818892 2:233057264-233057286 TGTGATCCTGGGTCCAGACTGGG - Intergenic
1169422289 20:5470413-5470435 TGTGCACCTGAGTGTATACAGGG - Intergenic
1173354752 20:42276826-42276848 TGTGATTCTGTGGATAAACAAGG + Intronic
1174963805 20:55187812-55187834 TCTGCTCCTGAGTCTAGATAAGG + Intergenic
1176782597 21:13215891-13215913 TGTTATCTTTAGTAGAGACAGGG + Intergenic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
1180958800 22:19753416-19753438 TGTGTGCCTGAGTATGAACATGG + Intergenic
1182775036 22:32824783-32824805 TTTGATACTGAGTAAAGACATGG + Intronic
1184820474 22:46905895-46905917 TTTCCTCCTGAGTCTAGACAAGG + Intronic
949454594 3:4225264-4225286 TGGGGTACTTAGTATAGACAGGG - Intronic
950482998 3:13256176-13256198 TGGGATGCTGAGTCTAGAGACGG + Intergenic
951350313 3:21599542-21599564 CGTGATCCATAGTATAAACATGG + Intronic
955193782 3:56786070-56786092 TGTGCTCCTGAGGACACACATGG - Intronic
956434590 3:69221566-69221588 TTTCATCCTGAGTAGAGGCAAGG - Intronic
962167853 3:133068917-133068939 TGTGAGGCTCAATATAGACAGGG + Intronic
962889654 3:139660152-139660174 TCTCCTCCTGAGTACAGACAGGG + Intronic
965847621 3:172983018-172983040 TGTGATCCTGCCTAAAGGCAAGG - Intronic
967028215 3:185582759-185582781 TGTGGTCCACAGTAGAGACATGG - Intronic
967566096 3:190974624-190974646 TTGAATCCAGAGTATAGACATGG + Intergenic
969442411 4:7225239-7225261 TGTGATCGTGGCTATAGTCATGG + Intronic
969893835 4:10284496-10284518 TCTTCCCCTGAGTATAGACAGGG + Intergenic
971575583 4:28269037-28269059 TGTGAAACTGAGTATAGCTAAGG + Intergenic
972927812 4:44033579-44033601 GGTGATCATAAGCATAGACATGG + Intergenic
973339681 4:48991345-48991367 TGTCTTCCTGAGTATAAAGATGG + Intronic
974433644 4:61830480-61830502 AATGATCTTGAATATAGACATGG - Intronic
977329669 4:95621765-95621787 TGGGACCCTGAGTAGTGACATGG - Intergenic
977576267 4:98677533-98677555 CTTGATGCTGAGAATAGACAGGG + Intergenic
978394482 4:108263815-108263837 TGTTGTCCTCAGTATAGTCATGG + Intergenic
978750111 4:112236775-112236797 TATCATCCTGAGTATACAAAGGG - Intronic
979807389 4:124991341-124991363 TGTTTTTCTGAATATAGACATGG + Intergenic
985801850 5:2009643-2009665 TGTGATTCTGACTGTAGTCATGG + Intergenic
987019926 5:13859801-13859823 TTTGATCCAGAGCATAGAGAAGG + Intronic
993419019 5:87676589-87676611 TGTGAGCCTGAGTAGAAACTGGG + Intergenic
998632702 5:143917788-143917810 TTTGATCCTGGGAATATACAGGG - Intergenic
998884944 5:146684484-146684506 TGTGATCCTGATTAGATACCTGG + Intronic
998962802 5:147506931-147506953 TTTGAAGCTGAGTATAGACATGG + Intronic
1002813361 6:656359-656381 GATGACCCTGAGTATAGAGACGG - Exonic
1004606357 6:17198627-17198649 TGTGATTTTTAGTAGAGACAGGG + Intergenic
1005310910 6:24557941-24557963 TGTCATCCTGATTGTAGAGATGG + Intronic
1005920059 6:30393326-30393348 TGTGATCCTTTGTACAGACAGGG + Intergenic
1006596890 6:35200249-35200271 TGTGATCCTAAGTGAAGTCAAGG - Intergenic
1007877422 6:45121399-45121421 TGACTTCCTGAGTATTGACAAGG + Intronic
1008527613 6:52421847-52421869 GGTGTTGGTGAGTATAGACAGGG + Intronic
1009674830 6:66805130-66805152 TGTAATTCTTAGTACAGACAGGG - Intergenic
1012238280 6:96843270-96843292 TGTAAGCCTTAGTAGAGACATGG + Intergenic
1012315407 6:97779264-97779286 GGTGATGCTGATTATAGCCATGG + Intergenic
1012468825 6:99547191-99547213 TGTCATCCTTAGCAAAGACATGG - Intronic
1016751849 6:147639052-147639074 TGTGATTCTAAAGATAGACAAGG + Intronic
1018316694 6:162563126-162563148 TGTATTCCTTAGTAAAGACAGGG - Intronic
1019744293 7:2690966-2690988 TGTTATCTTTAGTAGAGACAGGG - Intronic
1021277852 7:18677111-18677133 TGTGAGTCTGAGTATAAAGAGGG - Intronic
1024757833 7:52557199-52557221 TGAGCTCCTGATTATTGACAGGG - Intergenic
1026309198 7:69169009-69169031 TTTGATATTGAGTAGAGACAAGG - Intergenic
1026967731 7:74451057-74451079 TTTAATCTTTAGTATAGACAGGG - Intergenic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1032676280 7:134132762-134132784 TGGGACCCTGAGTAGAGAGAAGG + Intronic
1032731833 7:134650746-134650768 TGTTATCTTTAGTAGAGACAGGG - Intronic
1037875694 8:22546693-22546715 TGTGATCCTAATAATAGACATGG + Intronic
1039404558 8:37301410-37301432 TGAGGGCCTGAGGATAGACATGG + Intergenic
1040759586 8:50823091-50823113 TGGTATTCTTAGTATAGACAGGG + Intergenic
1041445997 8:57951468-57951490 TGTTATACTGAGAATAGACAGGG - Intergenic
1047343414 8:124004497-124004519 TGTTATCCTGAGAGTAGTCATGG - Intronic
1049864744 8:144927286-144927308 TGTGATTTTCAGTAGAGACAGGG - Intergenic
1051018664 9:12513771-12513793 TGAAATTCTGAGTATAAACAAGG + Intergenic
1053689485 9:40576411-40576433 TGTGGCCCTGAGTAGAGGCATGG - Intergenic
1054274546 9:63054646-63054668 TGTGGCCCTGAGTAGAGGCATGG + Intergenic
1054300730 9:63377350-63377372 TGTGGCCCTGAGTAGAGGCATGG - Intergenic
1054400278 9:64710283-64710305 TGTGGCCCTGAGTAGAGGCATGG - Intergenic
1054433869 9:65194541-65194563 TGTGGCCCTGAGTAGAGGCATGG - Intergenic
1054496517 9:65827129-65827151 TGTGGCCCTGAGTAGAGGCATGG + Intergenic
1055206346 9:73735295-73735317 TCTGATCATGATTAAAGACAAGG + Intergenic
1059380796 9:113922142-113922164 TGTGATCCTGGGGATAAACCAGG + Intronic
1059818996 9:117950867-117950889 TGTGATTCTCAGTATAGGGATGG + Intergenic
1061209069 9:129180351-129180373 TGTGATTTTTAGTAGAGACAGGG - Intergenic
1186846810 X:13539077-13539099 TGTGATTCTTGGTCTAGACAGGG + Intergenic
1194419627 X:93657559-93657581 TCTAGTCCTGAGTATGGACAAGG + Intergenic
1194528706 X:95015746-95015768 TGTGCTTCTGAATATATACAAGG - Intergenic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic
1199742784 X:150751398-150751420 TATGATCCTGTTAATAGACAAGG + Intronic
1201439832 Y:13995524-13995546 TGTAATCATGAGTATAGACTAGG + Intergenic
1201444739 Y:14047184-14047206 TGTAATCATGAGTATAGACTAGG - Intergenic
1201458671 Y:14198835-14198857 TTTGTTACTGATTATAGACATGG + Intergenic
1202589583 Y:26468433-26468455 TGTAATTTTTAGTATAGACAAGG - Intergenic