ID: 1062809002

View in Genome Browser
Species Human (GRCh38)
Location 10:447967-447989
Sequence TGTGATCCTGAATATCAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 3, 2: 2, 3: 10, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062809002_1062809008 -6 Left 1062809002 10:447967-447989 CCCCGTTGATATTCAGGATCACA 0: 1
1: 3
2: 2
3: 10
4: 84
Right 1062809008 10:447984-448006 ATCACACACAGTGGGGCAGCAGG No data
1062809002_1062809011 21 Left 1062809002 10:447967-447989 CCCCGTTGATATTCAGGATCACA 0: 1
1: 3
2: 2
3: 10
4: 84
Right 1062809011 10:448011-448033 GCTCACTCCCACTGATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062809002 Original CRISPR TGTGATCCTGAATATCAACG GGG (reversed) Intronic
900568279 1:3346002-3346024 TGTGAGCGTGCATATCAAAGGGG + Intronic
902170447 1:14606129-14606151 AGTGATCCTGGATGTCAAAGTGG - Intronic
902777683 1:18685050-18685072 TCTGGTCCTGAAAACCAACGTGG - Intronic
903760158 1:25692099-25692121 TGTGATCCAGAATGTTAACTGGG + Intronic
906896525 1:49779254-49779276 TGTGATCCTAAATGTCAAAATGG + Intronic
910787862 1:91020908-91020930 TGTGATCATCAAACTCAACGAGG - Intronic
911379240 1:97091550-97091572 TGTGGCCGTTAATATCAACGTGG + Intronic
913442872 1:118917609-118917631 TGTAAGCATGAATATCAAAGTGG + Intronic
922499954 1:226089583-226089605 TGGGTTCCTGAATAACCACGTGG + Intergenic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808948 10:447667-447689 TGTGATCCTGAATATCAATGGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809064 10:448316-448338 TGTGATCCTGAATATCAATGGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809204 10:449118-449140 TATGATCCTGAGTATCAACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1076150401 10:128157679-128157701 TGTGGACCTTAATATCAACGTGG - Intergenic
1076599777 10:131649987-131650009 TGTGACTCTGTAAATCAACGGGG - Intergenic
1086966791 11:93036112-93036134 GGTGATACTGAAAACCAACGGGG + Intergenic
1095568147 12:43650260-43650282 TGTAATCCTCAGTATCAAGGAGG - Intergenic
1100871299 12:98913322-98913344 TATGGTCCTGAATGTCAAGGAGG - Intronic
1101338304 12:103817203-103817225 TTTGATCCTGAATTTCATCTAGG - Intronic
1104375812 12:128265451-128265473 TTTGAGCCTGAACATCACCGGGG - Intergenic
1107675321 13:42790374-42790396 AGTGATGCAGAATATCAAGGAGG + Exonic
1115004893 14:28469666-28469688 TGTGTCCCTGAATACCCACGTGG - Intergenic
1116699205 14:48217141-48217163 TTTGATACTGAATATCAAGCAGG + Intergenic
1120672974 14:87385958-87385980 TGTGATCATGAGTATCATGGGGG + Intergenic
1120787097 14:88548058-88548080 TGAAAACCTGAATATCAACCAGG + Intronic
1123804539 15:23857706-23857728 TGTGATACTGCATATCATAGAGG - Intergenic
1129805629 15:78454813-78454835 TGTGATCCTAACTACTAACGAGG - Intronic
1129852223 15:78800009-78800031 TGTTATCCTAGAGATCAACGAGG + Intronic
1131800367 15:96062571-96062593 TGTGTCCCTAAATATCACCGTGG - Intergenic
1132474052 16:123789-123811 TGTGATCCTGTTTCTCAGCGTGG - Intronic
1132474056 16:123818-123840 TGTGATCCTGTTTCTCAGCGTGG - Intronic
1132474075 16:123934-123956 TGTGATCCTGTTTCTCAACGTGG - Intronic
1132474094 16:124050-124072 TGTGATCCTGTTTCTCAGCGTGG - Intronic
1133052797 16:3127199-3127221 GGTGATCCTGAAATTCAAAGTGG - Intergenic
1133991104 16:10708241-10708263 TGTGGTTCTGAATATCCAAGAGG - Intergenic
1150596320 17:66608914-66608936 GGTGATCCTGAAAATCAGCCAGG + Intronic
1156179925 18:34591177-34591199 TGTGATTCTAAATATTAACGTGG - Intronic
1163189656 19:15667223-15667245 TGTGCTCCTGATTAGCAAAGTGG + Intergenic
1163380057 19:16960066-16960088 TGTGATGATGAAGATGAACGTGG - Intronic
1165825179 19:38701665-38701687 TGTGGTCCTGGTTATCTACGTGG - Intronic
1166906475 19:46113440-46113462 CGTAATCCTGGATATCTACGTGG - Intergenic
926346993 2:11955962-11955984 TGACATACTGGATATCAACGCGG - Intergenic
926362033 2:12098332-12098354 TGTGCTCATGAAAATAAACGGGG + Intergenic
929320378 2:40536900-40536922 TGTGAGCCTGAAAAACAACAGGG + Intronic
930627783 2:53718196-53718218 TGTGAACGTGAATATCACCATGG + Intronic
945493235 2:210480100-210480122 TGTGATCCTGAATGGCCACATGG - Intronic
1170423444 20:16215083-16215105 TGTGATCCTGAAAATCCCTGTGG - Intergenic
1172040296 20:32040211-32040233 TCTGAGCCTGAATCTCAAAGAGG - Intergenic
1173470453 20:43319638-43319660 TGGGATCCTGAACATCCATGTGG + Intergenic
1173904587 20:46616831-46616853 TGGGAACCTGAATATCAGCTGGG + Intronic
1174053502 20:47783451-47783473 TGTGAAACTGCATATCAACTGGG + Intronic
1176664039 21:9667836-9667858 GATGATCCTGAAAATCAACTGGG - Intergenic
1177522930 21:22253495-22253517 TGTGATGCTGGATATCAGTGAGG + Intergenic
1179678984 21:43004723-43004745 TGTCATCATGAAAATCAACCGGG - Intronic
952078529 3:29728647-29728669 TGTGATCCTTAATATTAGCTTGG - Intronic
963309565 3:143694366-143694388 TCTGAACCTGAATATCCATGAGG + Intronic
965010335 3:163079978-163080000 CGTGATCCTGAATAACTACTGGG + Intergenic
971303579 4:25461803-25461825 TGGGATCCCAAATATCAACAAGG + Intergenic
972131157 4:35835129-35835151 TGTGTTCCTGAAGAACAATGTGG + Intergenic
980235793 4:130104411-130104433 TGTGATTTTTAATATCAACAAGG - Intergenic
980501456 4:133659714-133659736 TGTGCTCTTGAATAACAATGAGG + Intergenic
981833062 4:149024031-149024053 TTTGATGCTGACTATCAAGGGGG + Intergenic
985422600 4:189799673-189799695 TGGGATCCTGAATAACCAGGTGG - Intergenic
988066430 5:26232249-26232271 TGTGATGCTGAAGAACCACGTGG - Intergenic
988283218 5:29176390-29176412 TGTGATCATGGATTTCAACTGGG + Intergenic
995044740 5:107633165-107633187 TGTTATCCTTAATACCAATGGGG + Intronic
996921037 5:128768020-128768042 TGTGATCACGAATTTCAAAGAGG - Intronic
997910841 5:137871484-137871506 TCTAATCCTGAATATCCACTTGG + Intronic
1005466041 6:26114501-26114523 TATGATCCTGAATAGCAATTTGG + Intergenic
1007837611 6:44686115-44686137 TTTGATCCTGAACATGAAAGAGG + Intergenic
1015186088 6:130417820-130417842 TTTGATTATGAATATCAACCAGG - Intronic
1015186119 6:130418215-130418237 TTTGATTATGAATATCAACCAGG - Intronic
1016986075 6:149896903-149896925 TGTGGTCCTGAATCTCAGCTTGG + Intronic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1052154584 9:25168977-25168999 TCTGTTCCTGAATAACAACTGGG + Intergenic
1053563846 9:39226374-39226396 TGGGATGCTGAAGATCAAGGTGG + Intronic
1054133302 9:61392696-61392718 TGGGATGCTGAAGATCAAGGTGG - Intergenic
1055230152 9:74053359-74053381 TGTAATCCTGAATATTTAAGGGG + Intergenic
1203662061 Un_KI270753v1:53916-53938 GATGATCCTGAAAATCAACTGGG + Intergenic
1187451938 X:19405529-19405551 TGTGATCCTGGATTGGAACGTGG + Intronic