ID: 1062809030

View in Genome Browser
Species Human (GRCh38)
Location 10:448117-448139
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 6, 1: 3, 2: 3, 3: 15, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062809030_1062809039 21 Left 1062809030 10:448117-448139 CCCCATCTATACTCAGGATCACA 0: 6
1: 3
2: 3
3: 15
4: 164
Right 1062809039 10:448161-448183 GCTCACTCCCGTCGATACTCAGG No data
1062809030_1062809036 -6 Left 1062809030 10:448117-448139 CCCCATCTATACTCAGGATCACA 0: 6
1: 3
2: 3
3: 15
4: 164
Right 1062809036 10:448134-448156 ATCACACACAGTGGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062809030 Original CRISPR TGTGATCCTGAGTATAGATG GGG (reversed) Intronic
900464678 1:2819899-2819921 TGTGAACCCCAGGATAGATGCGG + Intergenic
900928010 1:5718203-5718225 TGTGATCCTGTCTCCAGATGTGG - Intergenic
902055516 1:13597613-13597635 TGCGATGCTGAGTCTAGATGGGG - Intronic
902508319 1:16952308-16952330 TGTGATTTTTAGTAGAGATGGGG - Intronic
903978292 1:27166513-27166535 TGAAATCATGAGAATAGATGAGG - Intronic
904869923 1:33610453-33610475 GGGGAACCTGAGTGTAGATGGGG + Intronic
906921856 1:50072981-50073003 GGTGAAACTGGGTATAGATGGGG - Intronic
908059357 1:60330482-60330504 TGGGAAACTGAGTATTGATGAGG - Intergenic
908903503 1:68982665-68982687 TGTGACCCTTATGATAGATGAGG - Intergenic
909344871 1:74573087-74573109 TGTGGGTCTGAGTAAAGATGAGG - Exonic
909455920 1:75848563-75848585 TTTGATCCTTTGTAGAGATGGGG - Intronic
910440288 1:87244822-87244844 TGTGTTCCTGACTTAAGATGAGG - Intergenic
910593724 1:88955616-88955638 TGTGATCCTGATTATTGTTTAGG + Intronic
911447638 1:98018237-98018259 TGACATCCTGAGTACAGTTGGGG - Intergenic
914688328 1:150002706-150002728 TGTGATCCTGAGTAAACCTCAGG + Intronic
914688471 1:150003862-150003884 TGTGAGCTGGAGTAAAGATGGGG - Intronic
915935071 1:160085735-160085757 TGAGATCTAGAGGATAGATGAGG + Intronic
916139758 1:161685395-161685417 GGTGATCCTGGGTTTAAATGTGG - Intergenic
919071830 1:192765558-192765580 TATGATCATGAGGATGGATGTGG + Intergenic
920096844 1:203492038-203492060 TGCGAGCCTGAGTCTGGATGTGG + Intergenic
923692740 1:236211843-236211865 GGTGTTCCTGAGTATAGACTAGG - Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808948 10:447667-447689 TGTGATCCTGAATATCAATGGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809064 10:448316-448338 TGTGATCCTGAATATCAATGGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064156099 10:12904520-12904542 TGTGGTCCTAAGGATAGAGGAGG - Intronic
1070430189 10:76330176-76330198 TGTGACCCTTATAATAGATGAGG - Intronic
1074058693 10:109944798-109944820 TCTCATCCTGAGTATAAATAAGG + Intronic
1074075287 10:110117839-110117861 TGTTATCTTTAGTAGAGATGGGG - Intronic
1079850333 11:25525282-25525304 TGTTATCTTTAGTAGAGATGGGG + Intergenic
1080226796 11:29970889-29970911 TGTGATACTGAGTTCAGATCTGG - Intergenic
1081867775 11:46369032-46369054 TGTGATTTTTAGTAGAGATGGGG - Intronic
1083105015 11:60348931-60348953 TCTTCTCCTGAGTATAGAAGTGG - Intronic
1085252860 11:75155014-75155036 GGTCATCCTGGGTCTAGATGGGG + Intronic
1087360595 11:97154174-97154196 TGTGATATTCAGTATAGTTGAGG + Intergenic
1088424259 11:109684871-109684893 TATGTTCCTGAGTCTAGAAGGGG + Intergenic
1088886592 11:114012512-114012534 AGTGAGCCTGAGTGTAGATAAGG + Intergenic
1090956966 11:131521718-131521740 TGTGATCCTCAGTATGGGAGGGG - Intronic
1091146827 11:133287592-133287614 TGTGAACCAGTGTATAGAGGAGG + Intronic
1098785384 12:74747898-74747920 TGTTATCCTCAGCAGAGATGGGG - Intergenic
1101272215 12:103159685-103159707 TGTGAACCTGAGTATTGAAGGGG - Intronic
1102289995 12:111691766-111691788 TGTGTTTTTGAGTAGAGATGGGG + Intronic
1104805919 12:131589131-131589153 TTTTATCTTTAGTATAGATGGGG + Intergenic
1106224656 13:27775776-27775798 TGTGGTCCTGAGTACACGTGGGG + Intergenic
1106589220 13:31084936-31084958 TGTAATCATGAGTTTAGATTGGG - Intergenic
1106895207 13:34292703-34292725 TGTGATGCTGTGTATAGCTGTGG - Intergenic
1108898456 13:55365693-55365715 TATAATGCTGAGTATGGATGGGG - Intergenic
1109037384 13:57283172-57283194 TTTGAACCTGACTATAGCTGTGG + Intergenic
1110088934 13:71420155-71420177 TGTGATCCTGAGTAGTGTTTTGG - Intergenic
1111557755 13:89904259-89904281 TGTGTTCTTTAGTAGAGATGGGG + Intergenic
1113981898 13:114282844-114282866 TATGCTCTTGAGTAGAGATGAGG - Exonic
1115636319 14:35293047-35293069 TGTGAGCTTCAGTATAGAAGAGG - Intronic
1118180451 14:63487102-63487124 AGAGGGCCTGAGTATAGATGTGG - Intronic
1121550381 14:94795237-94795259 TTTGATCCTTTGTAGAGATGGGG - Intergenic
1122104858 14:99445149-99445171 TGAGAGCCTGAGTATTGGTGAGG - Intronic
1124598487 15:31111484-31111506 TGTGTTCCTGAGAAGAAATGTGG + Intronic
1129542538 15:76362583-76362605 TTTTATCCTTAGTAGAGATGGGG + Intronic
1130972653 15:88745891-88745913 TGTGGTCATGAGTGTAGCTGTGG - Intergenic
1132712066 16:1273336-1273358 TGTGTTCCTGAGTGTGGGTGCGG - Intergenic
1133373270 16:5262474-5262496 TCTTCTCCTGAGTTTAGATGTGG + Intergenic
1133628224 16:7592264-7592286 TGAGAACTTGAGAATAGATGAGG + Intronic
1133845853 16:9453273-9453295 TGTGATTTTTAGTAGAGATGAGG - Intergenic
1134816695 16:17211735-17211757 TGGGAGCCTGAGTGAAGATGAGG - Intronic
1135719260 16:24801129-24801151 TGTGAAGCTCAGAATAGATGGGG + Intronic
1138627708 16:58265790-58265812 GGTGATGCTGAGTCAAGATGTGG - Intronic
1138912011 16:61412339-61412361 TTTGATGATGAGTATAGATGGGG + Intergenic
1144613481 17:16746624-16746646 TATGCTCTTGAGTAGAGATGAGG + Intronic
1145133152 17:20376700-20376722 TATGCTCTTGAGTAGAGATGAGG + Intergenic
1148060639 17:44833662-44833684 TGTGATCCTTATGATGGATGAGG + Intergenic
1150113755 17:62526128-62526150 TGCAAATCTGAGTATAGATGAGG + Intronic
1150549949 17:66200967-66200989 TGTGAGTGTGAGTATATATGTGG - Intergenic
1151070530 17:71205477-71205499 TGTGATCCTGTGGATGAATGAGG + Intergenic
1152555867 17:81052845-81052867 TGTGATCCTCAGGAAAGATCAGG + Intronic
1159072492 18:63641374-63641396 TGAGTTCCTGAGAATAGTTGAGG - Intronic
1159073936 18:63659013-63659035 TGAGTTCCTGAGAATAGTTGAGG - Intronic
1159934518 18:74351884-74351906 TGTGAACCTGTGTTTTGATGGGG + Intronic
1162295763 19:9812098-9812120 TGTGATTTTTAGTAGAGATGAGG + Intronic
1163633479 19:18428293-18428315 TGTGAGCCTGCGTGGAGATGGGG + Intronic
1164658878 19:29944988-29945010 TGACATCCTGAGTGTAGAAGGGG + Intronic
1165958988 19:39518977-39518999 GGTGATCCTGAGTAAAGGTCCGG + Exonic
1166954853 19:46456706-46456728 TTTGATCTTGTGTAGAGATGGGG - Intergenic
926289798 2:11519627-11519649 TGTGTTTCTTAGTAGAGATGGGG + Intergenic
927139955 2:20123111-20123133 TGAGATCCTGAGGGTAGGTGTGG - Intergenic
927316304 2:21687096-21687118 TGTGATACTGGTTATAGCTGAGG + Intergenic
932781040 2:74558659-74558681 TGTGAACCTGAGCATGGATATGG + Exonic
942847623 2:180445270-180445292 TATCATTCTGAATATAGATGTGG + Intergenic
944548179 2:200819214-200819236 TGTGATTTTTAGTAGAGATGAGG - Intronic
947084823 2:226438909-226438931 TGTGAGCCTGAGTTTAGGTGAGG - Intergenic
1174963805 20:55187812-55187834 TCTGCTCCTGAGTCTAGATAAGG + Intergenic
1175267837 20:57713354-57713376 TGTGAGCCTCAGTATGGCTGGGG - Intergenic
1177775406 21:25561496-25561518 TGACATCCCGAGTATAAATGCGG + Intergenic
1182636084 22:31728118-31728140 TGGGCTCCTGAATATGGATGAGG + Intronic
1183016552 22:34992983-34993005 TTTCATCCTGAGTAAAGGTGTGG - Intergenic
1184459443 22:44628644-44628666 TGGGGTCCTGAGTCTCGATGAGG + Intergenic
950218343 3:11175710-11175732 TGTTAACCTGATTCTAGATGTGG - Intronic
950254773 3:11495370-11495392 TCTCATCCTGAGGAGAGATGAGG + Intronic
952745384 3:36772012-36772034 TGTCAGCCTGTGTGTAGATGTGG + Intergenic
955772305 3:62397499-62397521 TGTTATCCTCATTATAGATTAGG - Intergenic
957432355 3:80127149-80127171 TGTGATCCTATGGACAGATGAGG - Intergenic
957466857 3:80604467-80604489 AATGATCCTGAGTATAAAAGGGG + Intergenic
959575596 3:107929512-107929534 TGTGATAATGAGTACAGTTGAGG - Intergenic
960124418 3:113982904-113982926 AGAGACCATGAGTATAGATGCGG + Intronic
960745937 3:120888686-120888708 TCTGTTGCTGAGGATAGATGAGG + Intergenic
960821513 3:121738015-121738037 TTTAATCCTGACTATAGCTGTGG - Intronic
962830934 3:139139645-139139667 TTTAATCCTTAGTAGAGATGGGG + Intronic
963453324 3:145513639-145513661 TGTGATCCTTATGATGGATGAGG - Intergenic
964992764 3:162834842-162834864 TGTGATCTTGAGTTTTGCTGAGG + Intergenic
964993029 3:162838354-162838376 TGTAAGACTGAATATAGATGGGG - Intergenic
965562502 3:170075052-170075074 TGTTATTCTTAGTAGAGATGGGG - Intronic
966087249 3:176083309-176083331 TGTAATTTTTAGTATAGATGGGG - Intergenic
967154748 3:186682149-186682171 TGTGACCCTGAGGATGGGTGAGG - Intergenic
967156338 3:186695950-186695972 TGTGACCCTGAGGATGGGTGAGG - Intergenic
969799877 4:9555428-9555450 TCTTCTCCTGAGTGTAGATGTGG + Intergenic
970846227 4:20541304-20541326 TGTGATTCTGAGTAAGAATGGGG + Intronic
970948870 4:21728679-21728701 TGTGATCCAGAGTGAAGAAGAGG - Intronic
971575583 4:28269037-28269059 TGTGAAACTGAGTATAGCTAAGG + Intergenic
972780736 4:42285028-42285050 TGTGATTTTTAGTAGAGATGGGG + Intergenic
975416640 4:74112499-74112521 TGGGAGCCGGAGTCTAGATGAGG - Intergenic
975654928 4:76632040-76632062 TGGGATCATGAGTCAAGATGGGG + Intronic
978336923 4:107679120-107679142 TGTGCTCCTGAGTCTTGAGGTGG - Intronic
983136898 4:164095327-164095349 TGTGATTGTGAGGATAAATGAGG + Intronic
984937748 4:184904153-184904175 AGTTATCCTGAGTTTGGATGAGG + Intergenic
985115953 4:186591028-186591050 TGGGCTTCTGTGTATAGATGCGG - Intronic
986019294 5:3786197-3786219 TGTGAGCGTGAGTGTGGATGTGG - Intergenic
988962820 5:36386528-36386550 TCTGTTCCTGAGTAAACATGTGG - Intergenic
989386287 5:40857979-40858001 TGTGTTTCTCAGTAGAGATGGGG + Intronic
992770982 5:80047817-80047839 CGTTATCCTTAGTAGAGATGGGG + Intronic
992771123 5:80049431-80049453 TGTTATCCTTAGTAGAGATGGGG + Intronic
994687132 5:102969450-102969472 TGTCATCCAGAGCAGAGATGGGG + Intronic
995042245 5:107602270-107602292 TGTAATTCTGAATATTGATGAGG + Intronic
999114243 5:149148604-149148626 TGTGATACAGAGTAGGGATGCGG - Intronic
1000366455 5:160495782-160495804 TGTGCTTCTGAGAATACATGGGG + Intergenic
1001149964 5:169218708-169218730 TAAGATCATGCGTATAGATGTGG + Intronic
1001445722 5:171781317-171781339 TCTGCTCCTTAGTATACATGTGG - Intergenic
1004681283 6:17897341-17897363 AGTGATACTGATTATAGCTGTGG - Intronic
1010839418 6:80630804-80630826 TGTTGTCCTGAGCATAGCTGTGG - Intergenic
1011652229 6:89517040-89517062 TCTGATTTTTAGTATAGATGGGG + Intronic
1013143129 6:107359822-107359844 CTTGATCCTGAGGAGAGATGGGG + Intronic
1013222852 6:108094921-108094943 TGTGATTTTTAGTAGAGATGAGG + Intronic
1014017271 6:116547530-116547552 TGTGATGATGAGTACAGCTGTGG - Intronic
1023252212 7:38277067-38277089 TGATCTCCTGAGTACAGATGAGG + Intergenic
1024925516 7:54609649-54609671 ACTGATCCAGAGTATACATGTGG - Intergenic
1025665884 7:63583029-63583051 TGAGATCGTGGGTATGGATGGGG - Intergenic
1025887092 7:65606465-65606487 TGTGATTCTGTGTATACTTGGGG + Intergenic
1026483994 7:70801975-70801997 TGTGATCATGACTTTAGGTGGGG + Intergenic
1027850479 7:83445415-83445437 TGTCATCAAGAGTATAGGTGGGG + Intronic
1032786755 7:135207173-135207195 TGTGATCCTGAACTTTGATGCGG - Exonic
1038242701 8:25824428-25824450 TCTGAGCCTCAGTACAGATGTGG - Intergenic
1038576089 8:28704132-28704154 TGTGATCTTGAAAATAGAAGAGG + Intronic
1040427960 8:47308233-47308255 TGTGCTTCTTAGTAGAGATGGGG + Intronic
1041277331 8:56176222-56176244 TGTTATCTTTAGTAGAGATGGGG + Intronic
1045846124 8:106638474-106638496 AGTGATACAGAGGATAGATGAGG - Intronic
1047986697 8:130242751-130242773 TGTGATCATGAGTAGAGTTGTGG + Intronic
1048610881 8:136021850-136021872 TGTGTTTATGAGTATAAATGTGG - Intergenic
1049226280 8:141452022-141452044 TGTGAAACTGAGTGTAGCTGAGG + Intergenic
1051082206 9:13306987-13307009 TGTGTTTCTTAGTAGAGATGCGG + Intergenic
1053286803 9:36855016-36855038 TGTGATCCTCTGTAAAGAAGAGG + Intronic
1054951573 9:70857989-70858011 AGTGCTCCTGAGCAGAGATGTGG + Intronic
1055963729 9:81844985-81845007 TGTTATTATTAGTATAGATGGGG + Intergenic
1058398309 9:104582147-104582169 TGTTATCCTGAGAATTAATGAGG - Intergenic
1058539181 9:105994148-105994170 TCTGATACTGACTATATATGAGG + Intergenic
1061551376 9:131336728-131336750 TGTGATCCTGTTTACAGAGGAGG - Intergenic
1062283150 9:135760778-135760800 TGTTCTCCTGAGTTCAGATGGGG + Intronic
1186705384 X:12135220-12135242 TGGGATCCTGAGTACATATGTGG - Intergenic
1187614319 X:20976678-20976700 TGTGATCCAGAGGGAAGATGAGG + Intergenic
1190518091 X:51245765-51245787 TGTGATCCTTTGTATTGCTGTGG - Intergenic
1190636138 X:52435833-52435855 TGTGATCCTGAGCTGAGGTGAGG + Intergenic
1190709035 X:53052468-53052490 TGTGATTGTGAGTGTATATGTGG + Intronic
1195039012 X:100996738-100996760 TTTGATCGTTAGTAGAGATGAGG - Intergenic
1195665874 X:107429861-107429883 TTTGATCTTTAGTAGAGATGGGG - Intergenic
1201439832 Y:13995524-13995546 TGTAATCATGAGTATAGACTAGG + Intergenic
1201444739 Y:14047184-14047206 TGTAATCATGAGTATAGACTAGG - Intergenic
1201624574 Y:16000500-16000522 TTTGGTGCTGATTATAGATGTGG - Intergenic