ID: 1062809131

View in Genome Browser
Species Human (GRCh38)
Location 10:448668-448690
Sequence TGTGATCCTGAATATCGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 2, 1: 4, 2: 7, 3: 10, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062809131_1062809136 -6 Left 1062809131 10:448668-448690 CCCTGTCGATATTCAGGATCACA 0: 2
1: 4
2: 7
3: 10
4: 59
Right 1062809136 10:448685-448707 ATCACACACAGTGGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062809131 Original CRISPR TGTGATCCTGAATATCGACA GGG (reversed) Intronic
906896525 1:49779254-49779276 TGTGATCCTAAATGTCAAAATGG + Intronic
910680977 1:89864113-89864135 TTTGATCCTCACTATTGACATGG - Intronic
911986454 1:104631187-104631209 TGTGTTCCTTAATATAGACCTGG - Intergenic
922354350 1:224761823-224761845 TCTGATTCAGAATATGGACAGGG - Intergenic
923042409 1:230328631-230328653 TGTGATGTTCAAGATCGACATGG + Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808948 10:447667-447689 TGTGATCCTGAATATCAATGGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809064 10:448316-448338 TGTGATCCTGAATATCAATGGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809204 10:449118-449140 TATGATCCTGAGTATCAACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1070208770 10:74292629-74292651 TTTTATCCTGAATAACGAGAAGG - Intronic
1072474757 10:95749639-95749661 TGTCCTCCCGAATATCCACATGG - Intronic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1082979624 11:59107500-59107522 GGTGTTCCTGAATCTCGAGAGGG + Intronic
1088208915 11:107430261-107430283 TGTGAGCCTGTATATGGATAGGG + Intronic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1120559387 14:85972297-85972319 TGTGCTCCTGAATGACTACAGGG - Intergenic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1126711059 15:51456633-51456655 GGTGCTCCTGAATATCCTCAGGG - Intronic
1131302452 15:91211371-91211393 TGTGATCCTGAAGACTGCCATGG - Intronic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1148800717 17:50223671-50223693 TGTGATCCTCAAAATTTACAAGG - Intergenic
1152033045 17:77855480-77855502 TGTGATGCTGAAAGTCCACAGGG - Intergenic
1155819619 18:30358859-30358881 TGTCTTCCTGAATAGCCACATGG - Intergenic
1155824081 18:30417090-30417112 TGTGATGCTTAATATTCACAGGG - Intergenic
1156437599 18:37149620-37149642 TGTGTACCTGAATATAGAAAAGG + Intronic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG + Intronic
1166639091 19:44479298-44479320 TGTGATCCTGGAGAACCACAGGG - Exonic
1167311047 19:48738272-48738294 TTTGATACTGAATATTGACAAGG - Intronic
929320378 2:40536900-40536922 TGTGAGCCTGAAAAACAACAGGG + Intronic
930627783 2:53718196-53718218 TGTGAACGTGAATATCACCATGG + Intronic
945493235 2:210480100-210480122 TGTGATCCTGAATGGCCACATGG - Intronic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
954380808 3:50218058-50218080 TGTGGTCCTGAATGTGGAGAGGG + Intronic
962167853 3:133068917-133068939 TGTGAGGCTCAATATAGACAGGG + Intronic
965010335 3:163079978-163080000 CGTGATCCTGAATAACTACTGGG + Intergenic
971303579 4:25461803-25461825 TGGGATCCCAAATATCAACAAGG + Intergenic
974433644 4:61830480-61830502 AATGATCTTGAATATAGACATGG - Intronic
979807389 4:124991341-124991363 TGTTTTTCTGAATATAGACATGG + Intergenic
980235793 4:130104411-130104433 TGTGATTTTTAATATCAACAAGG - Intergenic
989715702 5:44459620-44459642 TATGATCCTGAAAGTCGTCATGG + Intergenic
992890571 5:81200337-81200359 TGTGAGCATCAATATCGATAGGG + Intronic
997910841 5:137871484-137871506 TCTAATCCTGAATATCCACTTGG + Intronic
1013048124 6:106507851-106507873 TATGATCTTGGATATCCACAGGG + Intergenic
1016751849 6:147639052-147639074 TGTGATTCTAAAGATAGACAAGG + Intronic
1018831522 6:167447387-167447409 TGTATTCCTGGATATCCACAAGG - Intergenic
1020321469 7:6941597-6941619 TGAGAACCTGCATTTCGACAAGG + Intergenic
1024757833 7:52557199-52557221 TGAGCTCCTGATTATTGACAGGG - Intergenic
1025620539 7:63166252-63166274 TGTGATTTTGAATATTGCCATGG + Intergenic
1027882645 7:83861051-83861073 GGTCATCATGAATATGGACAGGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1033556692 7:142494370-142494392 TGTGATCCTGAATCTTGGAATGG - Intergenic
1035910400 8:3559282-3559304 TGTGAACATGAAGATCGCCATGG + Intronic
1037875694 8:22546693-22546715 TGTGATCCTAATAATAGACATGG + Intronic
1050620434 9:7446688-7446710 TGTGATCTCCAATATCTACAGGG - Intergenic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1057149141 9:92780810-92780832 TGGGATCCTGAAAATTGAGATGG + Intergenic
1186078387 X:5904837-5904859 TGTGACCTTAAAAATCGACAGGG - Intronic
1193187128 X:78526773-78526795 TGGGATCCTCAAAATTGACATGG + Intergenic
1194528706 X:95015746-95015768 TGTGCTTCTGAATATATACAAGG - Intergenic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic