ID: 1062809136

View in Genome Browser
Species Human (GRCh38)
Location 10:448685-448707
Sequence ATCACACACAGTGGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062809130_1062809136 -5 Left 1062809130 10:448667-448689 CCCCTGTCGATATTCAGGATCAC 0: 2
1: 5
2: 2
3: 4
4: 51
Right 1062809136 10:448685-448707 ATCACACACAGTGGGGCAGCAGG No data
1062809132_1062809136 -7 Left 1062809132 10:448669-448691 CCTGTCGATATTCAGGATCACAC 0: 3
1: 12
2: 13
3: 7
4: 49
Right 1062809136 10:448685-448707 ATCACACACAGTGGGGCAGCAGG No data
1062809127_1062809136 3 Left 1062809127 10:448659-448681 CCCACTCACCCCTGTCGATATTC 0: 2
1: 4
2: 3
3: 13
4: 76
Right 1062809136 10:448685-448707 ATCACACACAGTGGGGCAGCAGG No data
1062809131_1062809136 -6 Left 1062809131 10:448668-448690 CCCTGTCGATATTCAGGATCACA 0: 2
1: 4
2: 7
3: 10
4: 59
Right 1062809136 10:448685-448707 ATCACACACAGTGGGGCAGCAGG No data
1062809128_1062809136 2 Left 1062809128 10:448660-448682 CCACTCACCCCTGTCGATATTCA 0: 2
1: 4
2: 3
3: 13
4: 112
Right 1062809136 10:448685-448707 ATCACACACAGTGGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062809136 Original CRISPR ATCACACACAGTGGGGCAGC AGG Intronic
No off target data available for this crispr