ID: 1062809149

View in Genome Browser
Species Human (GRCh38)
Location 10:448768-448790
Sequence TGTGATCCTGAGTATCGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 3, 1: 6, 2: 6, 3: 9, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062809149_1062809154 -6 Left 1062809149 10:448768-448790 CCCTGTCGATACTCAGGATCACA 0: 3
1: 6
2: 6
3: 9
4: 67
Right 1062809154 10:448785-448807 ATCACACACAGTGGGGCAGCAGG No data
1062809149_1062809157 21 Left 1062809149 10:448768-448790 CCCTGTCGATACTCAGGATCACA 0: 3
1: 6
2: 6
3: 9
4: 67
Right 1062809157 10:448812-448834 ACTCATCCTCATCTATACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062809149 Original CRISPR TGTGATCCTGAGTATCGACA GGG (reversed) Intronic
901337432 1:8463262-8463284 TTTGATCCTGAGGCTCTACAAGG + Intronic
908554137 1:65240190-65240212 TGTGATGCTGAGGATTGACTGGG + Intergenic
910680977 1:89864113-89864135 TTTGATCCTCACTATTGACATGG - Intronic
911497563 1:98650185-98650207 TGTGATCCTGAGGCTGGACCAGG + Intergenic
923393960 1:233542523-233542545 TGTGATGCTGTGTATCCCCAGGG + Intergenic
923420822 1:233813222-233813244 TGTAATACTGAGTTTCGAGAGGG - Intergenic
923692740 1:236211843-236211865 GGTGTTCCTGAGTATAGACTAGG - Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808948 10:447667-447689 TGTGATCCTGAATATCAATGGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809064 10:448316-448338 TGTGATCCTGAATATCAATGGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809204 10:449118-449140 TATGATCCTGAGTATCAACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1068052352 10:51966801-51966823 AGTGATGCTGAGCATTGACAAGG - Intronic
1069614128 10:69795808-69795830 TATGATTCTGTGTATTGACAGGG - Intergenic
1071286484 10:84152261-84152283 TAGGATGCTGAGTATCTACATGG + Exonic
1073840631 10:107495228-107495250 TGTGTTTCTTAGTATAGACAGGG - Intergenic
1074045756 10:109837562-109837584 TGTAATCCTGAGAAACCACAAGG + Intergenic
1077167756 11:1151457-1151479 TGTGACCCTCAGTCTCGCCAAGG - Intergenic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1092141464 12:6186549-6186571 TGAGATCCTGGGTATGGAAAAGG + Intergenic
1096021142 12:48326581-48326603 TGTGACCCTGAGGATTTACATGG - Intergenic
1101272215 12:103159685-103159707 TGTGAACCTGAGTATTGAAGGGG - Intronic
1101933703 12:109037935-109037957 TGTAATTCTGAGTATCTAGAAGG - Intronic
1106673401 13:31931550-31931572 GATGATCCTGAGTATCCAGATGG + Intergenic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1117779247 14:59215585-59215607 TGTTATCCTGAGCTCCGACAGGG - Intronic
1117794159 14:59374664-59374686 TGTGATGCTGAGCAAGGACACGG + Intergenic
1118319627 14:64745576-64745598 TATGATGCTGAGTAACCACAAGG - Exonic
1122131885 14:99609018-99609040 TGTGATGCTGAGTGTCTGCAAGG + Intergenic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1124580683 15:30952242-30952264 TGTGATGCTGAGTAGCAGCAGGG - Intronic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1152350351 17:79780761-79780783 TGTGATCCTGTGCGTCGCCAAGG - Intronic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1163810789 19:19430126-19430148 TGTGTTCTTGAGTACTGACATGG + Intronic
1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG + Intronic
1167311047 19:48738272-48738294 TTTGATACTGAATATTGACAAGG - Intronic
932781040 2:74558659-74558681 TGTGAACCTGAGCATGGATATGG + Exonic
932850538 2:75180205-75180227 TGTAATTTTGAGTACCGACAAGG - Intronic
940405300 2:153294262-153294284 TGGGAACCTGAGTATTGAGAAGG - Intergenic
940834975 2:158511019-158511041 TGTGAGCCTGAGTATGGTGAAGG + Intronic
944199879 2:197095254-197095276 TGTGATCCTCAGTACAAACATGG - Intronic
944942169 2:204640468-204640490 TGTGACCCTGGGTAAAGACATGG - Intronic
945493235 2:210480100-210480122 TGTGATCCTGAATGGCCACATGG - Intronic
946688461 2:222294021-222294043 TCTGCGCCTGAGTAACGACATGG - Intronic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
1180958800 22:19753416-19753438 TGTGTGCCTGAGTATGAACATGG + Intergenic
1182775036 22:32824783-32824805 TTTGATACTGAGTAAAGACATGG + Intronic
952570478 3:34710125-34710147 TGTGATCCTGAGTGGCAAAAAGG - Intergenic
956760474 3:72438996-72439018 TCCAATCCTGAGTATCAACAAGG - Intronic
960357927 3:116676660-116676682 TGTGGTCCTGAGCAGCCACAAGG + Intronic
970617783 4:17783493-17783515 TGTGTCCCTCAGTATCAACAGGG + Intergenic
977329669 4:95621765-95621787 TGGGACCCTGAGTAGTGACATGG - Intergenic
985907258 5:2849546-2849568 TGTGAACCTGAGGAACGTCATGG - Intergenic
989314530 5:40062247-40062269 TGTGTCCCTCAGTATCCACAGGG + Intergenic
998962802 5:147506931-147506953 TTTGAAGCTGAGTATAGACATGG + Intronic
1005920059 6:30393326-30393348 TGTGATCCTTTGTACAGACAGGG + Intergenic
1007877422 6:45121399-45121421 TGACTTCCTGAGTATTGACAAGG + Intronic
1010934992 6:81850238-81850260 AGTGATCCTGAGTACCCATATGG - Intergenic
1022331331 7:29382076-29382098 GGTAATCATGAGGATCGACAGGG + Intronic
1024757833 7:52557199-52557221 TGAGCTCCTGATTATTGACAGGG - Intergenic
1028491559 7:91417991-91418013 TGTGATGCTGAGTGGCGACTTGG + Intergenic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1037875694 8:22546693-22546715 TGTGATCCTAATAATAGACATGG + Intronic
1041445997 8:57951468-57951490 TGTTATACTGAGAATAGACAGGG - Intergenic
1049235976 8:141512522-141512544 TGGGCTCCTGAGTATCCCCATGG + Intergenic
1186559874 X:10600072-10600094 ATTCATCCTGAGTATCTACAGGG + Intronic
1194419627 X:93657559-93657581 TCTAGTCCTGAGTATGGACAAGG + Intergenic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic
1196985181 X:121261507-121261529 GGTGTTCCTGAGAATCAACAAGG + Intergenic
1201439832 Y:13995524-13995546 TGTAATCATGAGTATAGACTAGG + Intergenic
1201444739 Y:14047184-14047206 TGTAATCATGAGTATAGACTAGG - Intergenic