ID: 1062809214

View in Genome Browser
Species Human (GRCh38)
Location 10:449168-449190
Sequence TGTGATCCTGAGTATTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 6, 2: 5, 3: 23, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062809214_1062809221 23 Left 1062809214 10:449168-449190 CCCTGTCAATACTCAGGATCACA 0: 1
1: 6
2: 5
3: 23
4: 139
Right 1062809221 10:449214-449236 TCACCCCCGTCGATACTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062809214 Original CRISPR TGTGATCCTGAGTATTGACA GGG (reversed) Intronic
903824915 1:26137511-26137533 TGTGCTCCAGAGTCTTGACTTGG + Intergenic
907568710 1:55462439-55462461 AGTGATACTGGGTATTGGCATGG - Intergenic
908554137 1:65240190-65240212 TGTGATGCTGAGGATTGACTGGG + Intergenic
908686742 1:66729202-66729224 TTTGATTCAGTGTATTGACATGG + Intronic
908820626 1:68082486-68082508 TACGATCCTGAGCAATGACAAGG + Intergenic
909443513 1:75723941-75723963 TGAGACCCTGAGTTTTGAGATGG - Intergenic
910593724 1:88955616-88955638 TGTGATCCTGATTATTGTTTAGG + Intronic
910680977 1:89864113-89864135 TTTGATCCTCACTATTGACATGG - Intronic
911497563 1:98650185-98650207 TGTGATCCTGAGGCTGGACCAGG + Intergenic
917181290 1:172300964-172300986 TCTGCTCTTGAGTATTGCCAAGG - Intronic
919280871 1:195486380-195486402 TGAGACAATGAGTATTGACAAGG + Intergenic
920358067 1:205390864-205390886 TGTGTTCCTGTGTATTTAAATGG - Intronic
923692740 1:236211843-236211865 GGTGTTCCTGAGTATAGACTAGG - Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808860 10:447219-447241 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808901 10:447419-447441 TGTGATCCTGAGTATAGATGGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809030 10:448117-448139 TGTGATCCTGAGTATAGATGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809158 10:448818-448840 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809174 10:448918-448940 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809190 10:449018-449040 TGTGATCCTGAGTATAGATGAGG - Intronic
1062809204 10:449118-449140 TATGATCCTGAGTATCAACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1066422715 10:35277369-35277391 TGTGACCCTGAGACTTGAGATGG - Intronic
1068052352 10:51966801-51966823 AGTGATGCTGAGCATTGACAAGG - Intronic
1068700639 10:60015972-60015994 TATGATGCCGAGTATTGCCAAGG - Intergenic
1069614109 10:69795600-69795622 TATGATTATGTGTATTGACAGGG - Intergenic
1069614128 10:69795808-69795830 TATGATTCTGTGTATTGACAGGG - Intergenic
1071207493 10:83298144-83298166 TGTGATACTGATTATTTAAATGG + Intergenic
1073840631 10:107495228-107495250 TGTGTTTCTTAGTATAGACAGGG - Intergenic
1078438175 11:11342747-11342769 TGTGAACCTGAGTAGTCTCATGG - Intronic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1080623245 11:34005156-34005178 TGTGATTCTGTGGGTTGACAGGG - Intergenic
1085671864 11:78473983-78474005 TGTGATGCTGAGGATTCTCAGGG - Intronic
1089388259 11:118082011-118082033 TGTGATCGTGAGTGATGTCAGGG - Intronic
1092141464 12:6186549-6186571 TGAGATCCTGGGTATGGAAAAGG + Intergenic
1096021142 12:48326581-48326603 TGTGACCCTGAGGATTTACATGG - Intergenic
1097654868 12:62346011-62346033 TGTGAACTTGACTATTGATATGG - Intronic
1101272215 12:103159685-103159707 TGTGAACCTGAGTATTGAAGGGG - Intronic
1104611061 12:130228193-130228215 TGAGATGATGAGTATTGCCAGGG + Intergenic
1106468066 13:30030549-30030571 TGTGACCCTGATTATTCCCAAGG + Intergenic
1108383271 13:49874626-49874648 TGAGATGATGAGTATTGCCAAGG - Intergenic
1110000353 13:70190395-70190417 TGTGATACTAAGTAGTGACGTGG + Intergenic
1110088934 13:71420155-71420177 TGTGATCCTGAGTAGTGTTTTGG - Intergenic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1110471161 13:75861756-75861778 TGTGATCCTCAGAAATTACAGGG - Intergenic
1113679579 13:112233930-112233952 TGTGATACTGAGTCTTCAAATGG + Intergenic
1116585707 14:46700261-46700283 TGAGATGATGAGTATTGCCAAGG - Intergenic
1117794159 14:59374664-59374686 TGTGATGCTGAGCAAGGACACGG + Intergenic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1125298578 15:38229996-38230018 TGTAATACAGTGTATTGACATGG - Intergenic
1126352784 15:47762454-47762476 TGTGAACAGGAGCATTGACAGGG + Intronic
1126551455 15:49935324-49935346 TGAGAACCTGAGCATTGCCAAGG + Intronic
1129987565 15:79931903-79931925 TATTATTCTGAGTATTGACTTGG + Intergenic
1131302452 15:91211371-91211393 TGTGATCCTGAAGACTGCCATGG - Intronic
1134504384 16:14793096-14793118 TGGGAACCTGAGGCTTGACAAGG - Intronic
1134576189 16:15335813-15335835 TGGGAACCTGAGGCTTGACAAGG + Intergenic
1134726254 16:16420689-16420711 TGGGAACCTGAGGCTTGACAAGG - Intergenic
1134941178 16:18291171-18291193 TGGGAACCTGAGGCTTGACAAGG + Intergenic
1137453811 16:48602678-48602700 TGTAATACTGGGTAGTGACATGG - Intronic
1138411407 16:56843278-56843300 TGTGAATGTGAGTATTGAGATGG + Intronic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1146288564 17:31591806-31591828 TGTGAACCTGAGGGTTGACTTGG + Intergenic
1148800717 17:50223671-50223693 TGTGATCCTCAAAATTTACAAGG - Intergenic
1155369656 18:25084155-25084177 TGTAATTCTGACTATTAACAAGG + Intronic
1155824081 18:30417090-30417112 TGTGATGCTTAATATTCACAGGG - Intergenic
1155856727 18:30844100-30844122 TCTGTTTCTGATTATTGACAGGG - Intergenic
1158224615 18:55187715-55187737 TGTGATTGTGAGAATTGAAAAGG + Intergenic
1159741658 18:72178713-72178735 TGTGATCCCCAGTGTTGAAAGGG - Intergenic
1159764544 18:72472210-72472232 TGTGATTCTGATACTTGACAGGG + Intergenic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1163810789 19:19430126-19430148 TGTGTTCTTGAGTACTGACATGG + Intronic
1163953837 19:20615681-20615703 TGTGACCCTGAGTCTTTACCTGG + Intronic
1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG + Intronic
1167311047 19:48738272-48738294 TTTGATACTGAATATTGACAAGG - Intronic
928723908 2:34149180-34149202 TATGAGCCTGAGTGTTGACTTGG - Intergenic
931964479 2:67518198-67518220 TGAGACACTGAGTATTGGCAAGG + Intergenic
932781040 2:74558659-74558681 TGTGAACCTGAGCATGGATATGG + Exonic
935762324 2:106332797-106332819 TGAGATGATGAGTATTGCCAAGG - Intergenic
935962841 2:108444297-108444319 TGAGATGATGAGTATTGCCAAGG + Intergenic
939580259 2:143938252-143938274 TGTGATCCTGATTAATTAAAAGG - Exonic
940405300 2:153294262-153294284 TGGGAACCTGAGTATTGAGAAGG - Intergenic
940834975 2:158511019-158511041 TGTGAGCCTGAGTATGGTGAAGG + Intronic
941109666 2:161405218-161405240 TGTGATACTTAGTAGTAACAGGG - Intronic
944199879 2:197095254-197095276 TGTGATCCTCAGTACAAACATGG - Intronic
944942169 2:204640468-204640490 TGTGACCCTGGGTAAAGACATGG - Intronic
945211819 2:207391137-207391159 TCTGGTCTTGAGTATTGAAATGG - Intergenic
1170474154 20:16698328-16698350 TGAGATCACGAGTATTGTCAGGG - Intergenic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
1180958800 22:19753416-19753438 TGTGTGCCTGAGTATGAACATGG + Intergenic
1182775036 22:32824783-32824805 TTTGATACTGAGTAAAGACATGG + Intronic
949776758 3:7641833-7641855 TGTGATCTTAAGAATTTACAAGG - Intronic
956968203 3:74489107-74489129 TGTGTTTCAGAGTATTCACAAGG - Intronic
960355878 3:116652674-116652696 TGTTATGCTGTGTATTGATAGGG - Intronic
964135572 3:153341400-153341422 TGTAATGATGAGAATTGACATGG + Intergenic
964869614 3:161298985-161299007 TGAGACCATGAGTATTGCCAGGG + Intergenic
965015877 3:163156016-163156038 TGAGATGCTGAGTATTGCTAAGG + Intergenic
970535929 4:17029757-17029779 TGTGATCCGTATTTTTGACATGG - Intergenic
971834130 4:31739812-31739834 TGTGACCCAGAGACTTGACAAGG + Intergenic
972623864 4:40777094-40777116 TGAAATCCTGAGTATTTACCAGG - Intronic
974538892 4:63207422-63207444 TGAGATGATGAGTATTGCCAAGG + Intergenic
977329669 4:95621765-95621787 TGGGACCCTGAGTAGTGACATGG - Intergenic
978336923 4:107679120-107679142 TGTGCTCCTGAGTCTTGAGGTGG - Intronic
979733088 4:124048559-124048581 TTTCAACCTGAGTTTTGACAGGG - Intergenic
985104828 4:186490058-186490080 TGAGATGATGAGTATTGCCAAGG - Intronic
988045752 5:25950850-25950872 TGAGACAATGAGTATTGACACGG + Intergenic
988514089 5:31890092-31890114 TGCCCTCCTGAGCATTGACAAGG + Intronic
989197654 5:38731530-38731552 TGTGTCCCTGAGTGTTGACTTGG - Intergenic
990765984 5:59183281-59183303 TGTCACCCTGGGCATTGACAAGG + Intronic
991247773 5:64526062-64526084 TGAGACAATGAGTATTGACAAGG + Intronic
996176495 5:120365914-120365936 TGAGATGATGAGTATTGCCAAGG + Intergenic
998962802 5:147506931-147506953 TTTGAAGCTGAGTATAGACATGG + Intronic
1005316717 6:24609791-24609813 TATGAGCCTGACTTTTGACAAGG + Intronic
1005920059 6:30393326-30393348 TGTGATCCTTTGTACAGACAGGG + Intergenic
1007877422 6:45121399-45121421 TGACTTCCTGAGTATTGACAAGG + Intronic
1011404282 6:87001488-87001510 TGAGACCATGAGTATTGCCAAGG + Intronic
1011940419 6:92835878-92835900 ATTGATGCTGACTATTGACAGGG + Intergenic
1012636789 6:101552717-101552739 TGTGCACCTGAGAATTGGCAAGG + Intronic
1019925471 7:4189273-4189295 TGTGAGCCTGGGTATTGTAATGG + Intronic
1020950898 7:14675644-14675666 TGTGGTCCTGAGTTTTGTCTAGG + Intronic
1024654792 7:51442531-51442553 TGAGACCATGAGTATTGCCAAGG + Intergenic
1024757833 7:52557199-52557221 TGAGCTCCTGATTATTGACAGGG - Intergenic
1024864453 7:53888724-53888746 TGAGATAATGAGTATTGCCAGGG + Intergenic
1025620539 7:63166252-63166274 TGTGATTTTGAATATTGCCATGG + Intergenic
1026424414 7:70275713-70275735 TGTGATAGTGAGTACTCACAAGG + Intronic
1029166467 7:98594934-98594956 TGGGACCCTGAGGATTGAGATGG - Intergenic
1030513239 7:110511178-110511200 TGGGATCCTCAGTCTTTACAAGG - Intergenic
1031670284 7:124534683-124534705 TCTGCTCCTGGGTATTCACATGG - Intergenic
1031883869 7:127225357-127225379 TGAGACCCTGAGCCTTGACAAGG - Intronic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1033552147 7:142457327-142457349 TGTGATCCTGGGTCTTGGAATGG - Intergenic
1033556692 7:142494370-142494392 TGTGATCCTGAATCTTGGAATGG - Intergenic
1033559051 7:142513826-142513848 TGTGATCCTGGGTCTTGGAATGG - Intergenic
1034945170 7:155257519-155257541 CTTGATCCTGACCATTGACAAGG + Intergenic
1035194186 7:157201783-157201805 TGTGATCATCCGTGTTGACATGG - Exonic
1036547361 8:9784821-9784843 TGAGATGATGAGTATTGCCAAGG + Intergenic
1037875694 8:22546693-22546715 TGTGATCCTAATAATAGACATGG + Intronic
1037972240 8:23180857-23180879 TGAGACACTGAGTATTGCCACGG + Intergenic
1041445997 8:57951468-57951490 TGTTATACTGAGAATAGACAGGG - Intergenic
1045042656 8:98241369-98241391 TTTAAGGCTGAGTATTGACAAGG + Intronic
1045209247 8:100078453-100078475 TGTGATACTAATTATTGATATGG + Intronic
1046855901 8:119031581-119031603 TGTGATGCTGATGATTGGCAAGG + Intronic
1047312014 8:123699914-123699936 AGTAATGCTCAGTATTGACAAGG - Intronic
1047836198 8:128695873-128695895 TCGGATCCTGAGGAATGACAAGG - Intergenic
1048559208 8:135514805-135514827 TGAGATCCTGAGGACTGAAATGG - Intronic
1051922458 9:22283973-22283995 TGTGATACTGAGTTCTCACAAGG - Intergenic
1054918466 9:70518148-70518170 TGTGAACCTGAGAATTGAACTGG + Intergenic
1056994134 9:91439751-91439773 TCTGATCCTCTGAATTGACAAGG - Intergenic
1057149141 9:92780810-92780832 TGGGATCCTGAAAATTGAGATGG + Intergenic
1062683366 9:137797001-137797023 TGTGATCTTGAGAATTTAAAAGG + Intronic
1185582711 X:1223378-1223400 TGTGATTCTGAGGGCTGACAGGG + Intergenic
1186661817 X:11675511-11675533 TGAGATGATGAGTATTGCCAGGG - Intergenic
1186828611 X:13366954-13366976 CTTGATTCTGAGTATTGGCAAGG - Intergenic
1188182008 X:27067434-27067456 TGAGATGATGAGTATTGCCAAGG - Intergenic
1190194419 X:48304995-48305017 TCTGTCCCTGAGTAATGACATGG + Intergenic
1190660927 X:52653620-52653642 TCTGTCCCTGAGTAATGACATGG + Intronic
1193187128 X:78526773-78526795 TGGGATCCTCAAAATTGACATGG + Intergenic
1194419627 X:93657559-93657581 TCTAGTCCTGAGTATGGACAAGG + Intergenic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic
1196237321 X:113298582-113298604 TATCATCCTTAGTATTGAAATGG + Intergenic
1201439832 Y:13995524-13995546 TGTAATCATGAGTATAGACTAGG + Intergenic
1201444739 Y:14047184-14047206 TGTAATCATGAGTATAGACTAGG - Intergenic