ID: 1062810509

View in Genome Browser
Species Human (GRCh38)
Location 10:459928-459950
Sequence GCTCACGTGCAGCAGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062810509_1062810514 6 Left 1062810509 10:459928-459950 CCAACCACCTGCTGCACGTGAGC 0: 1
1: 1
2: 0
3: 9
4: 140
Right 1062810514 10:459957-459979 ACCTTCCCACAGTCACATCAGGG No data
1062810509_1062810513 5 Left 1062810509 10:459928-459950 CCAACCACCTGCTGCACGTGAGC 0: 1
1: 1
2: 0
3: 9
4: 140
Right 1062810513 10:459956-459978 GACCTTCCCACAGTCACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062810509 Original CRISPR GCTCACGTGCAGCAGGTGGT TGG (reversed) Intronic
901705660 1:11071159-11071181 GCTCACGTGTAGCTGAAGGTGGG - Intronic
903267568 1:22167115-22167137 GAGCACCTGCAGGAGGTGGTTGG + Intergenic
905231837 1:36519259-36519281 GCTCACGTGCAGGGGCTGCTGGG + Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905925578 1:41747129-41747151 TCTCTCCTGCAGCAGGTGTTTGG - Intronic
906539733 1:46576057-46576079 GCTCATTTGGAGCTGGTGGTGGG + Intronic
910518515 1:88089750-88089772 GCTCCAGTACAGCAAGTGGTTGG - Intergenic
920415035 1:205793438-205793460 GTTCCAGTGCAGCACGTGGTGGG - Intronic
922810182 1:228410940-228410962 GCTCACCTGCAGCATCTGGAGGG + Exonic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1066382445 10:34912909-34912931 CCTCACATGAGGCAGGTGGTCGG - Intergenic
1066394371 10:35004859-35004881 GTCCAAGTGCAGCAGGTGGTTGG - Intergenic
1067047335 10:42991977-42991999 ACTCTGGTGCTGCAGGTGGTGGG - Intergenic
1067088694 10:43255780-43255802 GCTCAGGACCACCAGGTGGTGGG + Intronic
1069852822 10:71421334-71421356 CCTCAGGTGGGGCAGGTGGTGGG - Intronic
1075593570 10:123710449-123710471 GATCAGGTGGAGCAGGTGGAGGG + Intronic
1076636052 10:131882544-131882566 GCACACGTGCAGTGTGTGGTGGG + Intergenic
1076679094 10:132162328-132162350 CTTCACGTGCACCTGGTGGTGGG - Intronic
1077074576 11:694580-694602 GGTCACGTGGAGCAGGTGTGAGG + Intronic
1077074590 11:694633-694655 GGTCACGTGGAGCAGGTGTGAGG + Intronic
1078545700 11:12245631-12245653 GCTGACCTGGAGCAGGTGGCTGG - Intronic
1082008907 11:47437565-47437587 GCTGACGTGCAGTGGGTGGGAGG - Intergenic
1083681330 11:64353191-64353213 GCTCAGGTCCAGCTGCTGGTTGG - Exonic
1089772348 11:120812752-120812774 GGCAACGTCCAGCAGGTGGTTGG + Intronic
1091981183 12:4865455-4865477 GCTCAGGACCAGCAGGTGGCTGG + Intergenic
1094842947 12:34349569-34349591 GCGCATGTGCAGCAGGGGGAGGG + Intergenic
1095244021 12:39897595-39897617 GCTCAAGAGCTGCATGTGGTTGG - Intronic
1101259447 12:103013550-103013572 GCAGGGGTGCAGCAGGTGGTGGG + Intergenic
1102361993 12:112296138-112296160 GTGTAGGTGCAGCAGGTGGTAGG + Intronic
1107824073 13:44311933-44311955 GCACATGGGCAGCGGGTGGTGGG - Intergenic
1118254785 14:64196073-64196095 GTTCACGTTCAGCAGGTTGCAGG + Intronic
1118453547 14:65925453-65925475 GCTCTCGGGCAGCAGATGATTGG + Intergenic
1119392129 14:74298025-74298047 GCTCACATACAGCAGGTTGCAGG + Exonic
1120062828 14:80004449-80004471 GATCACTTGCAGCATGTGGGAGG + Intergenic
1120955257 14:90076517-90076539 GCTCACGTACAGATGGGGGTTGG - Intronic
1202893703 14_KI270722v1_random:183455-183477 GCTGACGTGCCACAGTTGGTGGG + Intergenic
1131422451 15:92318633-92318655 GCCCATGTGGAGCAGGTGGTAGG + Intergenic
1139378924 16:66518048-66518070 GCTCCCAGGCAGCAGGAGGTCGG - Intronic
1139440661 16:66965029-66965051 GCTCGCAGGCAGCAGGTGGCTGG - Intronic
1141154005 16:81584174-81584196 GCCCACCAGCACCAGGTGGTGGG + Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141531112 16:84648022-84648044 GCTCAAGTGAAGCATGGGGTTGG + Intergenic
1141802451 16:86320041-86320063 GCTCACATGCCGAAGGTGGGAGG - Intergenic
1142288074 16:89179558-89179580 GCTCACCTGAACCAGGGGGTAGG - Exonic
1143101292 17:4506173-4506195 GCTGACGTGCAGAAGGTGAGCGG - Intronic
1143155352 17:4833145-4833167 GCGCACGCGCACCAGCTGGTGGG + Intergenic
1143354308 17:6314075-6314097 TCTCCCCTGCAGCAGGTGGGTGG - Intergenic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1147629920 17:41923520-41923542 ACTCACCTGCAGCAGGTTGCAGG - Intronic
1151756334 17:76077283-76077305 GCTCATGTGCAACAGGTCGCTGG - Exonic
1152378702 17:79931183-79931205 GCTCCCGTGGGGCAGGGGGTCGG + Intergenic
1152755613 17:82085797-82085819 GCTCAGCTGCAGCAGGGGATGGG + Exonic
1152791685 17:82283556-82283578 GCTCACTTGGGGCAGGTGGGAGG - Intergenic
1160683242 19:422158-422180 GTCCACGAGCAGCAGGTGCTTGG + Exonic
1163533223 19:17862769-17862791 GCTCACGGGAAGGTGGTGGTGGG - Intronic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167113480 19:47475347-47475369 GCTCACCTCCAGCCGCTGGTGGG - Exonic
1167376306 19:49114240-49114262 GCTGGCGCGCGGCAGGTGGTCGG + Intergenic
1167446798 19:49542718-49542740 GCTCTCGTGCAGCAGGTGGTTGG - Exonic
1168485645 19:56759927-56759949 GCCCAGGTGCAGCAGGTGCAGGG + Intergenic
1168691373 19:58379587-58379609 GCTCACCTGGGGCAGGTGGGAGG - Intronic
926118044 2:10225628-10225650 GCTCAGGTGCTGCAGCTGGGAGG - Intergenic
929833695 2:45374318-45374340 GCAGACGTGTAGCGGGTGGTGGG - Intergenic
933877462 2:86633251-86633273 GCCAACCTGCAGCAGATGGTTGG + Intronic
937672801 2:124556816-124556838 ACACAGGTGAAGCAGGTGGTGGG + Intronic
938314024 2:130314317-130314339 CCACTCGTCCAGCAGGTGGTTGG + Intergenic
946134481 2:217634463-217634485 GGTCACGTGCAGCGTGTGGTTGG - Intronic
946979434 2:225192079-225192101 TCTCACAGGTAGCAGGTGGTGGG + Intergenic
948295713 2:236858838-236858860 GCTCACTTGAAGCAGTTGGCAGG + Intergenic
1169324048 20:4661037-4661059 GCACATGTGCACAAGGTGGTTGG + Intergenic
1170924513 20:20711521-20711543 GATCACATGCAGCAGGTGACAGG + Intronic
1173955995 20:47033114-47033136 GCTCACCTGCAGCAGCAGCTGGG - Intronic
1174464105 20:50703842-50703864 GCCAACCTGCTGCAGGTGGTTGG - Intergenic
1175290119 20:57869981-57870003 GCTAAAGTGCAGCGGGTGGGAGG - Intergenic
1180074703 21:45456594-45456616 GCTCTCGTGGTGGAGGTGGTTGG - Intronic
1182442423 22:30372170-30372192 GCGCAGGTGCAGCTGTTGGTGGG + Exonic
1183590584 22:38777233-38777255 GCCCACGTGCAGCAGATGAAAGG + Intronic
1183704725 22:39469578-39469600 GCTCTCATGCACCAGGTGGCAGG - Intronic
1184287855 22:43482018-43482040 CCTCAGGTGCAGCCGGTGTTGGG + Intronic
1184835813 22:47020256-47020278 GCTGACCAGCAGCCGGTGGTGGG + Intronic
1185080020 22:48704530-48704552 GTGGACGTGCAGCAGGTGGCTGG + Intronic
1185084780 22:48734806-48734828 GGTCACCAGCAGCAGGTGCTGGG + Intronic
953987853 3:47459247-47459269 GCTCATGTGTAGCTGGTGGCAGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954746717 3:52791614-52791636 GCTCACGGTCACCAGGTGGGTGG + Exonic
960410317 3:117314946-117314968 GCTCAGGCGTATCAGGTGGTTGG - Intergenic
960701691 3:120445852-120445874 GCTCAGCTGCAGCAGGGGATAGG + Intronic
961002255 3:123381957-123381979 GCCCAAGTCCAGCTGGTGGTGGG + Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963785613 3:149531550-149531572 GCGCAGGTGCAGGAGGTGGGAGG - Intronic
965729701 3:171758263-171758285 GCTCACGTGACTCAGCTGGTGGG + Intronic
967994751 3:195158145-195158167 GAGCACCTGTAGCAGGTGGTGGG - Intronic
972336453 4:38111056-38111078 GCGCACCTGCAGCAGTTGGCCGG - Intronic
973969922 4:56203287-56203309 GCACAAGTGCTCCAGGTGGTCGG - Intronic
975106240 4:70571870-70571892 GCACACGTGTAGGAGGTGGGTGG + Intergenic
977942617 4:102875452-102875474 ACTCACATGTATCAGGTGGTGGG - Intronic
984336858 4:178403350-178403372 GCACATGTGGGGCAGGTGGTAGG - Intergenic
985380411 4:189388958-189388980 CCTCACATGTGGCAGGTGGTGGG - Intergenic
988598514 5:32617680-32617702 GATCAAGTGCAGCCGTTGGTGGG + Intergenic
992357669 5:76002382-76002404 GCTCACTTGTGACAGGTGGTGGG + Intergenic
997384089 5:133458885-133458907 GCTCTGGAGCAGCAGGGGGTAGG + Intronic
998333741 5:141352062-141352084 GCTGGCCTGCAGCACGTGGTAGG - Exonic
998334814 5:141361949-141361971 GCTGGCCTGCAGCACGTGGTAGG - Exonic
998337897 5:141389692-141389714 GCTAGCCTGCAGCACGTGGTAGG - Exonic
998339025 5:141399929-141399951 GCTAGCCTGCAGCACGTGGTAGG - Exonic
998343731 5:141441932-141441954 GCTGGCCTGCAGCACGTGGTAGG - Intronic
1002638872 5:180621197-180621219 GCTCACGTTCACCAGGAGGTCGG + Exonic
1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG + Intronic
1006230770 6:32584505-32584527 GCTCCTGGGCTGCAGGTGGTGGG - Intronic
1006806390 6:36792312-36792334 GCTCTCGGGGAGCAGGGGGTGGG - Intronic
1007654302 6:43443025-43443047 GCACCTGTGCAGCAGGTGGTTGG - Exonic
1007727813 6:43927253-43927275 GCACAGGTGCACCAGGTGGGTGG - Intergenic
1011633497 6:89349831-89349853 TGACATGTGCAGCAGGTGGTGGG - Intronic
1016662368 6:146596446-146596468 CCTGACATGGAGCAGGTGGTAGG - Intergenic
1018874111 6:167804724-167804746 GCTCTGCTGCAGCAGGTGATGGG - Intergenic
1019769812 7:2876600-2876622 GCCCACGGGCAGCAGGAGGATGG + Intergenic
1023718578 7:43069939-43069961 CCTCTGGTGCGGCAGGTGGTGGG + Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1032404379 7:131645143-131645165 GCTCAGGTGCACTTGGTGGTTGG - Intergenic
1032845467 7:135748178-135748200 GCCCAACTGCTGCAGGTGGTGGG + Intronic
1034081143 7:148278644-148278666 GCTCACATGTACCAGGTGCTAGG + Intronic
1034940798 7:155228918-155228940 GCACATGTGCTGCTGGTGGTTGG - Intergenic
1039038942 8:33388698-33388720 GATCCCGTGCTGCAGGTGCTGGG - Intronic
1041952863 8:63523976-63523998 GCTGACATGCAGTAGGTGCTTGG - Intergenic
1044608696 8:94071036-94071058 GCTCACCTGCAGCCTGTGGCTGG + Intergenic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1048560991 8:135537116-135537138 GCCCTCGTGCAGTAGGTGGCAGG + Intronic
1049327669 8:142032015-142032037 GCTCACGTGGAGCGGGGAGTGGG + Intergenic
1049614351 8:143569600-143569622 GCTCACGTGCCGCACCTGCTGGG + Exonic
1050217719 9:3346697-3346719 GCTCAGGTGCAGTATGTGGAAGG - Exonic
1051355731 9:16238326-16238348 GCTCCCTTGCAGCTGGGGGTTGG + Intronic
1053424074 9:37999663-37999685 TCCCACGTGCTGCTGGTGGTTGG - Intronic
1055275906 9:74615398-74615420 GCTCAGGCGCAGAAGGTGGGAGG - Intronic
1055783180 9:79842604-79842626 GCACATGTGCAGCAGTGGGTTGG + Intergenic
1056327185 9:85489645-85489667 CTTCAAGTCCAGCAGGTGGTTGG - Intergenic
1056716795 9:89038005-89038027 GTCCACGAGCAGCAGGTGCTTGG + Exonic
1056757303 9:89389895-89389917 GGTCACGGGCAGCAGGTGAAGGG + Intronic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1059393716 9:114017427-114017449 GCTCACGGGCACCAGGAGGATGG - Intronic
1059529487 9:115022950-115022972 CCTGACATGCAGCAGGTGTTGGG - Intronic
1060998336 9:127887478-127887500 GCTCACCTGCAGTAGTTGGGGGG + Exonic
1061161268 9:128895720-128895742 GCTGAGGAGCAGCAGCTGGTAGG + Intronic
1062311748 9:135941739-135941761 GCTCACGGGCTGCAGGACGTCGG + Intronic
1062402031 9:136376963-136376985 GCCCACTTGCAGCAGCTGGGAGG - Intronic
1190724192 X:53176431-53176453 GTCAACGGGCAGCAGGTGGTTGG + Intergenic
1192221976 X:69203544-69203566 GCTCACGGGCAGGGGCTGGTGGG - Intergenic
1195599945 X:106734811-106734833 GCCCTCTTGCAGCATGTGGTAGG + Intronic
1199171493 X:144739387-144739409 GAACACGTGCTCCAGGTGGTTGG - Intergenic
1200000571 X:153057755-153057777 GCTGCCTTGCAGCAGGTGTTCGG + Exonic
1200115247 X:153767174-153767196 GCTCACCAGCAGCAGCTGGTTGG - Exonic