ID: 1062812068

View in Genome Browser
Species Human (GRCh38)
Location 10:474484-474506
Sequence GGGGCTCCAAGAGGACTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062812068_1062812080 10 Left 1062812068 10:474484-474506 CCTGGAAGTCCTCTTGGAGCCCC 0: 1
1: 0
2: 3
3: 31
4: 225
Right 1062812080 10:474517-474539 CCAAACGTGCTACCGTCACTGGG No data
1062812068_1062812078 9 Left 1062812068 10:474484-474506 CCTGGAAGTCCTCTTGGAGCCCC 0: 1
1: 0
2: 3
3: 31
4: 225
Right 1062812078 10:474516-474538 CCCAAACGTGCTACCGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062812068 Original CRISPR GGGGCTCCAAGAGGACTTCC AGG (reversed) Intronic
900164568 1:1239582-1239604 CTGGCCCCAAGAGGACTTCCTGG + Intergenic
900313966 1:2048041-2048063 TGGGCACCCACAGGACTTCCTGG - Intergenic
900331388 1:2136431-2136453 GGAGAGCCCAGAGGACTTCCTGG + Intronic
900997775 1:6131712-6131734 GGACCTCCTGGAGGACTTCCTGG - Exonic
901836171 1:11925658-11925680 GCTGCTGCAAGAGGACTTTCTGG - Exonic
902798909 1:18817506-18817528 GGAAATCCAGGAGGACTTCCTGG + Intergenic
902981492 1:20126684-20126706 TGGGCTCCTGTAGGACTTCCTGG - Intergenic
904353845 1:29925937-29925959 GGGACTACCAGGGGACTTCCTGG - Intergenic
905915588 1:41682248-41682270 GGTGCTCAGAGAAGACTTCCTGG - Intronic
907194888 1:52678524-52678546 GAGGGTCCAGGATGACTTCCTGG + Intergenic
907466782 1:54643198-54643220 GGGATTCCAGGAAGACTTCCTGG + Intronic
911175207 1:94811356-94811378 AGGGTTCCAAGAAGCCTTCCTGG - Intergenic
911438870 1:97899537-97899559 GGGGTTCCAAGACCACCTCCAGG - Intronic
914417362 1:147496282-147496304 GGGGATCCAAGATGGCTTCAGGG + Intergenic
915720143 1:157978817-157978839 GGGGGACCCAGTGGACTTCCCGG - Intergenic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
923630416 1:235645945-235645967 GGGGCACCAGGAGGAGGTCCAGG + Intronic
924562532 1:245169110-245169132 GGGGCACCAAGTGGTGTTCCTGG - Intronic
924575524 1:245277455-245277477 GGGGCACCAAGAGCACCTTCAGG - Intronic
1062768062 10:80437-80459 CGGGCTGCATGAGGACCTCCAGG - Intergenic
1062812068 10:474484-474506 GGGGCTCCAAGAGGACTTCCAGG - Intronic
1066527463 10:36296826-36296848 TGGGCTCACAGTGGACTTCCAGG - Intergenic
1067134559 10:43596318-43596340 GGGGCTACAGGAGGATTACCAGG - Intergenic
1069786347 10:70990636-70990658 TGGTCCCCAAGAGGAATTCCCGG + Intergenic
1070637236 10:78139386-78139408 GGGGCTCCAGCAGGACTGCCGGG - Intergenic
1073514081 10:104061677-104061699 GGGGGTCTAGGAGGACTTCCTGG - Intronic
1074186893 10:111105569-111105591 AGGGATCAAAGAGGACTTCACGG - Intergenic
1075093480 10:119456361-119456383 GGAGCTCCTAGAGGACTTGGTGG + Intronic
1075797207 10:125129252-125129274 AGGGCCCCAAGGGGACTTTCCGG + Intronic
1076576719 10:131474410-131474432 GGGGCTCCAAGAGGGGTGCATGG + Intergenic
1076584345 10:131535070-131535092 GGGCCTCAAAGACGACCTCCAGG + Intergenic
1076728902 10:132428684-132428706 AGGGCTCCAAGCGGACTTCGAGG + Intergenic
1078064009 11:8066130-8066152 GGGGCTCCAAGGGTACTGCCAGG + Intronic
1078222350 11:9362444-9362466 GAGGCTCCAAGGGGGCCTCCAGG - Intergenic
1078364291 11:10693705-10693727 GGGGCTCCCAGAGGAGCTCTCGG - Exonic
1079349894 11:19683572-19683594 GGTGCTCCAAGAGAACATCCAGG - Intronic
1080696396 11:34606429-34606451 GGAGATCCCAGAGGCCTTCCTGG - Intergenic
1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG + Intronic
1084472581 11:69371848-69371870 GGGGGGCCAAGAGGACTTGAGGG + Intergenic
1084715564 11:70871300-70871322 GAGGGTCCAAGAGGAGGTCCAGG + Intronic
1085326320 11:75609434-75609456 GGGGCTCAGAGAGGAGTGCCAGG + Intronic
1085351019 11:75797910-75797932 GAGGGACCAAGAGAACTTCCTGG + Intronic
1087194545 11:95292401-95292423 GGAGATCCAAGAAGACCTCCCGG - Intergenic
1089364894 11:117915542-117915564 GGGGCTCCATGAGCACTCCAGGG - Intronic
1089562318 11:119350201-119350223 GGGCCAGCAGGAGGACTTCCTGG + Intergenic
1089638985 11:119834526-119834548 GGGGCTCAAGGAGGACTTCCTGG - Intergenic
1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG + Intergenic
1089770080 11:120796542-120796564 GGGGGTCAGAGAGGGCTTCCTGG + Intronic
1089832864 11:121344189-121344211 GTGGCTCCATGAGGCCTTCAGGG + Intergenic
1090954751 11:131504157-131504179 GGGGCTCAAAGGGGACTGGCAGG - Intronic
1091974657 12:4814681-4814703 AGAGCTCCCAGAGGACTTCCTGG + Intronic
1093718789 12:22414127-22414149 AGGGCTCTTAGAGGACTTCTAGG + Intronic
1093745153 12:22731759-22731781 AGGGATCCAAGAGGACTTCTTGG + Intergenic
1093888351 12:24489416-24489438 GGGGGTCTAAGTGGACTTGCGGG + Intergenic
1100675732 12:96864665-96864687 AGGACTCCTAGAGTACTTCCAGG + Intronic
1102461576 12:113103013-113103035 GGGACTCAAGGAGGGCTTCCTGG - Intronic
1103316921 12:120063738-120063760 GAGGATCCACGAGGACCTCCAGG + Intronic
1104391293 12:128392592-128392614 GGGTATCAAAGAAGACTTCCTGG + Intronic
1104509365 12:129362386-129362408 GCTGCTCCAAGAGGACTTCAAGG - Intronic
1114633120 14:24172227-24172249 AGAGCTCCAAGGGGACGTCCGGG - Exonic
1119123125 14:72098212-72098234 AGGGTTCAAAGAGGACCTCCAGG - Intronic
1119448084 14:74683413-74683435 TGGGCTCCTGAAGGACTTCCTGG + Exonic
1121866423 14:97366630-97366652 GGGCCTGCACGAAGACTTCCTGG - Intergenic
1122038018 14:98962403-98962425 GGGGACCCAGAAGGACTTCCAGG - Intergenic
1122366461 14:101197607-101197629 GTGGCTCCAGGAGGGCTTCCTGG + Intergenic
1122875927 14:104664846-104664868 GGGGTCCCAAGAGAACTGCCTGG + Intergenic
1125590733 15:40853287-40853309 GGGGCTCCAAGAAGGCTGGCAGG - Intronic
1125814089 15:42568969-42568991 GGGTCTCCAAGACTACCTCCAGG - Exonic
1127225207 15:56919772-56919794 GGGGCGCCGGGATGACTTCCAGG - Intronic
1129076351 15:72999662-72999684 GGAGGTCCAAGAGCAGTTCCGGG + Intergenic
1132250425 15:100331828-100331850 TGGGCTCCAGCAGGACCTCCAGG - Intronic
1132333759 15:101030186-101030208 GGGGCACCTAGAGGGCTACCTGG - Intronic
1132436179 15:101805290-101805312 GGGTATCAAAGAGGACTTCATGG + Intergenic
1132456957 16:29386-29408 TGGGCTGCATGAGGACCTCCAGG - Intergenic
1132704709 16:1238545-1238567 GGGCCTCCTGGAGGACTGCCTGG + Intergenic
1132706806 16:1247773-1247795 GGGCCTCCTGGAGGACTGCCTGG - Intergenic
1133034957 16:3029357-3029379 GGGGCTCTAAGATCTCTTCCGGG + Exonic
1133193912 16:4154776-4154798 GGGACTCAAGGAAGACTTCCTGG + Intergenic
1135065791 16:19308738-19308760 AGGGCTCCAGGAGGGCTCCCAGG - Intronic
1135115233 16:19718207-19718229 GCGACTCGAAGTGGACTTCCGGG - Exonic
1135397354 16:22141449-22141471 GGGGCTCCAAGATGGCTTCAAGG - Intronic
1135720186 16:24810627-24810649 AGGGTTCAAAGAGGACTGCCTGG + Intronic
1137547606 16:49415288-49415310 GGGGCCCAAAGAGCACTTGCGGG + Intergenic
1138514741 16:57529737-57529759 AGTGCTCCAGGAGGGCTTCCAGG - Intronic
1139939438 16:70594656-70594678 AGGGCCCAAAGAGGACTTTCTGG + Intronic
1142194475 16:88733130-88733152 GGGGCGCCAAGGGGGCTTCCTGG - Intronic
1142401398 16:89860647-89860669 GAGGCTCCATCAGGACTGCCTGG - Intronic
1142427032 16:90006849-90006871 GAGGCTCCAAGAGGCCTGCAGGG - Intronic
1143555388 17:7656620-7656642 GGGGCTGCTAGAGGATTTTCAGG - Exonic
1144806792 17:17972991-17973013 GAGGCTCCCGGAGGACTTGCAGG + Intronic
1145272744 17:21413379-21413401 GAGGCCCCAAGAGAACATCCTGG - Intronic
1145310952 17:21700842-21700864 GAGGCCCCAAGAGAACATCCTGG - Intronic
1146495399 17:33317801-33317823 GGAAATCCAAGAGGACTTCACGG + Intronic
1146536407 17:33656651-33656673 GAGGTTCCAGGAGGCCTTCCTGG - Intronic
1146660547 17:34662673-34662695 AGGGCTCCCATAGGACTCCCGGG + Intergenic
1146946701 17:36878242-36878264 GGTTCTCCAAGGGGAATTCCTGG - Intergenic
1147581801 17:41631236-41631258 GGGAATCCAAGAGGGCTTTCTGG - Intergenic
1148158693 17:45437675-45437697 GGGACACCACGGGGACTTCCTGG + Exonic
1148240995 17:45999186-45999208 GGGAATCCAGGAAGACTTCCTGG - Intronic
1148480284 17:47955602-47955624 GGGGCTCCATAAATACTTCCAGG + Intronic
1148842882 17:50510094-50510116 GGGCCTGCAAGAGCACATCCAGG - Intronic
1149654485 17:58303007-58303029 GGGCCCCTAAGAGGACTGCCGGG + Intronic
1151595752 17:75077273-75077295 GGGGCTCCAGGAGGATCCCCAGG - Intergenic
1156382254 18:36573915-36573937 AGGGCTTGAAGAGGACTTCGAGG + Intronic
1156539777 18:37898275-37898297 GGGGCACACAGAGGCCTTCCAGG - Intergenic
1158380121 18:56920270-56920292 GGGGCTATAAGAAGGCTTCCAGG - Intronic
1159926164 18:74270807-74270829 GGAGGTCCTAGAGGACTCCCTGG + Intronic
1161352895 19:3803671-3803693 GAGGCTCCCCGAGGGCTTCCTGG - Intergenic
1161730836 19:5959573-5959595 GGGTCTCCAACCAGACTTCCAGG + Intronic
1162006497 19:7783779-7783801 GAGGATCCGAGAGGGCTTCCTGG - Intergenic
1162440221 19:10687964-10687986 GAGGCTGCAAGGTGACTTCCTGG + Intronic
1162554522 19:11378499-11378521 AGCGCTCTGAGAGGACTTCCAGG + Exonic
1163444109 19:17336884-17336906 GGGGTTCCAGGAAGACTTCCTGG + Intronic
1163598938 19:18236552-18236574 GGGGCTCAGGGAGGACTACCTGG - Intronic
1164872417 19:31657005-31657027 GGGCCTCCAGAAGGACTTCTTGG + Intergenic
1165706816 19:37982298-37982320 TTGGCTCCCAGAGGCCTTCCTGG + Intronic
1165751558 19:38263748-38263770 GGGAGTCAAAGAGGGCTTCCTGG - Intronic
1166659625 19:44637813-44637835 GAGGATCCAGGAGGGCTTCCTGG + Intergenic
1166763528 19:45238962-45238984 GGGGTTCCGAGAGGACCTCAGGG + Intronic
1166870407 19:45867103-45867125 GGACCTCAAGGAGGACTTCCGGG + Intronic
1166876390 19:45900429-45900451 GGTGGTCCAGGAGGGCTTCCTGG - Intronic
1167153391 19:47723063-47723085 GGGGGTCAAGGAGGACTTCCAGG - Intronic
1167278640 19:48553669-48553691 GGGGCATGAAGAGGCCTTCCTGG + Intronic
1167620270 19:50556506-50556528 GGAGCTCAAAGAAGACCTCCTGG - Intronic
1168194667 19:54765278-54765300 GGGGCTTCAACACGATTTCCTGG + Intronic
1168315719 19:55483950-55483972 GTGTCTCAAAGAGGACATCCTGG - Exonic
925125585 2:1453532-1453554 GGGCCTCCAGGAGGCCTTTCGGG + Intronic
925342459 2:3146963-3146985 GGTGATCGATGAGGACTTCCTGG - Intergenic
927640430 2:24842151-24842173 TGGGCTTCAAGAGGTTTTCCAGG - Intronic
928199667 2:29239612-29239634 GTGCCTCCAAGAGGCCTTCCCGG + Intronic
929564858 2:42977950-42977972 AGGGCTCAAAGTGGACTTCTTGG + Intergenic
930218134 2:48718390-48718412 GGGGCTCTAAAAGCACTTCTGGG + Intronic
930828301 2:55716399-55716421 GGGACTCCAGGATGACTCCCAGG + Intergenic
931428649 2:62193049-62193071 GGGAGTCCATGAGGAGTTCCTGG - Intergenic
932334525 2:70922536-70922558 AGGGGACCAGGAGGACTTCCAGG - Intronic
932385402 2:71327917-71327939 GCGGCCACAAGAGGAGTTCCAGG + Intronic
933185545 2:79275059-79275081 GGGGCTCCAGTGGGACTACCTGG + Intronic
933737504 2:85507060-85507082 GAAGCTCCGAGAGGACTTCATGG - Intergenic
935741293 2:106150869-106150891 GGGGCTCCCAGAGGCCTTGGAGG + Intronic
936508689 2:113128571-113128593 GGGCCTCCAGGAGGATCTCCTGG - Intronic
936514627 2:113173998-113174020 GGCTCCCCAAGAGCACTTCCTGG - Exonic
937953984 2:127408733-127408755 GGCTCTCCAGGAAGACTTCCTGG - Intergenic
939032646 2:137094941-137094963 GGGGCTCCAGGAGGACCACTGGG - Exonic
939182045 2:138814992-138815014 GGAGCTACAACAGGGCTTCCAGG + Intergenic
940045102 2:149401476-149401498 GGGGCTCACAGAGGGCTTCCTGG - Intronic
941046050 2:160676983-160677005 TGGGTTCCAAAATGACTTCCAGG - Intergenic
942975704 2:182015014-182015036 AGAGCACCAAGAGGACTTCTAGG - Intronic
944645449 2:201775661-201775683 GGGGTTCCAAGTGGCCTTCTTGG - Intronic
947871131 2:233439157-233439179 GGAGCTCTAAGAGGACTTGCTGG + Intronic
948383591 2:237567894-237567916 GGGGAGCCCAGAGGACTTCTAGG - Intergenic
948940827 2:241195517-241195539 AGGACTCCAGGAGCACTTCCAGG - Intronic
1169142852 20:3235920-3235942 AGGGATCTAGGAGGACTTCCTGG - Intronic
1169262700 20:4149502-4149524 GGGGCCCCAAGGGGACCACCCGG - Intronic
1170554896 20:17506980-17507002 GTGGCTGCAGGAGGACTTCCTGG - Intronic
1172847339 20:37937833-37937855 GGGGGGCCAGGAGGGCTTCCTGG + Intronic
1173047093 20:39522869-39522891 GGGGCTCAAAGATCACCTCCTGG - Intergenic
1174462289 20:50691441-50691463 GGGGCCCCAGGAGGGCTTCCTGG - Exonic
1175282689 20:57814626-57814648 GAGGCTCCAAGATGGCTCCCAGG + Intergenic
1175367400 20:58465514-58465536 AGAGCTCCAAGAGGACTTCATGG + Intronic
1175731076 20:61354280-61354302 GGGGATCCAGGAGGACTGTCTGG - Intronic
1176277064 20:64278529-64278551 CGGGCTACATGAGGACCTCCAGG + Intronic
1180169324 21:46049822-46049844 TGGGCTTGAAGAGGGCTTCCTGG + Intergenic
1182991897 22:34776233-34776255 GGGATTCCAAGAGGACTTCCTGG + Intergenic
1183292292 22:37010235-37010257 GGGGTTGCAAGAAGAATTCCGGG - Intergenic
1183455774 22:37922316-37922338 GGTGCTCTCAGAGGCCTTCCTGG - Exonic
1184257330 22:43294700-43294722 GGCATTCCAGGAGGACTTCCTGG - Intronic
1184267888 22:43359568-43359590 GTGCCTCCAAGAGGGTTTCCTGG + Intergenic
1184414484 22:44344321-44344343 GGGGCTCAGAGAAGGCTTCCAGG - Intergenic
1185146547 22:49140098-49140120 GGGCATCCAGGGGGACTTCCTGG - Intergenic
950433769 3:12966900-12966922 AGGCCTGCAAGAGGCCTTCCTGG + Intronic
954308745 3:49747956-49747978 AGGGCTCCAGGAGGACTCCCCGG + Exonic
954686206 3:52371662-52371684 GGGGCTCCCTAAGGACTGCCAGG - Intronic
954710366 3:52502428-52502450 GGGGCTCACAGAGGGCTTCCTGG - Intronic
956870427 3:73411719-73411741 GTGTCTCCCAGAGCACTTCCTGG + Intronic
962309342 3:134314173-134314195 GGAGATCCAGGAGGGCTTCCTGG + Intergenic
962366841 3:134792457-134792479 TGGGCTCCAAGCGCACTCCCAGG + Intronic
964197084 3:154077347-154077369 GGGGCTTCAAGAGGGCATCCTGG - Intergenic
966931473 3:184678398-184678420 GGGGTTCACAGAGGGCTTCCTGG - Intronic
968662495 4:1804557-1804579 GGGGCTCCAGGAGGCCTGGCGGG - Intronic
969182118 4:5450236-5450258 GGGGCACCAAAAGGAATTCTGGG - Intronic
969354037 4:6614685-6614707 GGGGCTCCAGGAGGTTTCCCTGG - Intronic
970315396 4:14824365-14824387 GGAGCTGCAAGAGCACATCCAGG + Intergenic
970320792 4:14873572-14873594 GAGGCTCCAAGAAGGCTTCAGGG + Intergenic
981457819 4:144976387-144976409 GGGACACAAAGAGGGCTTCCAGG + Intronic
987032169 5:13986179-13986201 GCGGCTCCAAGAGGAATCGCTGG + Intergenic
987123293 5:14788083-14788105 AGGGCTCCAAGAAGCCTTCTTGG - Intronic
988609646 5:32712430-32712452 GGGGGTCCACGAGGTCTTCCAGG + Exonic
992551612 5:77865462-77865484 TGGGCTCCAAGTGGGCTTTCAGG + Intronic
993749699 5:91651464-91651486 GGAGCTCCATGAGGATTGCCTGG - Intergenic
997263159 5:132478967-132478989 GGTGCTCCAACAGGACTGCCTGG + Intergenic
997645581 5:135479446-135479468 GTGGCTCCAAGAGCACCTTCTGG + Intergenic
998878648 5:146625622-146625644 GGGGGTCCAGGAAGTCTTCCTGG + Intronic
1002098634 5:176846532-176846554 GGGCATCCAGGAGGGCTTCCTGG - Intronic
1002158640 5:177302284-177302306 GGTGCTCTAGGAGGTCTTCCTGG - Intronic
1002405624 5:179027889-179027911 TGGGCTCCTAGAGGACAACCAGG - Intronic
1003188178 6:3850465-3850487 GGGGCTGCGCAAGGACTTCCTGG + Exonic
1004196267 6:13508449-13508471 GGGGCTAGAAGGGGACTTCTTGG - Intergenic
1005409013 6:25522591-25522613 GGGCCTCTGAGAGGTCTTCCTGG - Intronic
1006401303 6:33819229-33819251 TGGGCTCCAGGAGGGCTCCCAGG + Intergenic
1006737351 6:36283921-36283943 AGGGCCCCAAAAGGACTTCTGGG + Intronic
1006903682 6:37518889-37518911 GGGGATCTAGGAAGACTTCCTGG - Intergenic
1007133540 6:39499258-39499280 GGAGGTGCAAGAGGGCTTCCTGG + Intronic
1007735874 6:43981847-43981869 GGGGGTCCAAAGGGACCTCCAGG + Intergenic
1007782244 6:44261107-44261129 CTGGCTCCATGAGGCCTTCCCGG + Intronic
1009247170 6:61252817-61252839 GGGGGTCAAGGAGGATTTCCTGG - Intergenic
1012073833 6:94657987-94658009 GGGGCTCCAAGTGAACTTGAGGG - Intergenic
1013467993 6:110434414-110434436 GGGGCTGCAGCAGAACTTCCAGG - Intronic
1013605004 6:111739372-111739394 GGGGCTCAAGGAGGACATACAGG + Intronic
1018105426 6:160481877-160481899 GGGTCTCCAAGAAGACAGCCAGG + Intergenic
1018267913 6:162044799-162044821 GGTGATCAAAGAGGACTTCATGG - Intronic
1019390596 7:784431-784453 GGGGGTCCAGGAGGACCTCAAGG - Intronic
1021378030 7:19932746-19932768 GGGAGTCCTTGAGGACTTCCTGG + Intergenic
1021478992 7:21094761-21094783 GGTGATGCAAGAGGACTGCCAGG - Intergenic
1022522603 7:31017703-31017725 GGGGCACTAAGGGGCCTTCCTGG - Intergenic
1023678079 7:42651738-42651760 GTGGCTCTAAGGGGACTTCAGGG - Intergenic
1024749704 7:52451134-52451156 GGAGCTCTAAGAGGACATCTTGG + Intergenic
1026499914 7:70935509-70935531 GGGGCTCCAGGGGGCCTCCCAGG - Intergenic
1026789897 7:73324709-73324731 GGGGCTCCTTGAAGACCTCCAGG + Exonic
1030192881 7:106826956-106826978 GGGGCCTCAATTGGACTTCCAGG + Intergenic
1033354061 7:140585413-140585435 GGGGCTCCAAGAGAACTAGAGGG + Intronic
1034964307 7:155382264-155382286 CGGGCTCCGAGAGGACTTGATGG + Exonic
1035649358 8:1253292-1253314 GGGGCTCCAGGAGAGCTGCCAGG + Intergenic
1036687848 8:10923724-10923746 GGGGCACCAAGAGGACCTGCGGG + Intronic
1039992348 8:42499092-42499114 GTGGCTCCAACAGGACTGCAGGG + Intronic
1040970742 8:53135195-53135217 GTAGATCCAAGAGGATTTCCTGG + Intergenic
1041707040 8:60857653-60857675 GGTGCTCCAGGAAGCCTTCCAGG + Intronic
1041810035 8:61897577-61897599 TGGGATCCAGAAGGACTTCCTGG - Intergenic
1042217400 8:66439653-66439675 GAGCCTCCAGGAGAACTTCCTGG - Intronic
1043524641 8:81083214-81083236 GGGCCTCCAACAATACTTCCTGG + Intronic
1045036111 8:98177830-98177852 CCTGCTCAAAGAGGACTTCCCGG - Intergenic
1047692635 8:127371906-127371928 GGGCCTCAAGGATGACTTCCTGG - Intergenic
1049424588 8:142532442-142532464 GAGGCTCCTGGAGGACCTCCTGG + Intronic
1049426494 8:142540241-142540263 TGGGCCCCAGGAGGGCTTCCTGG + Intronic
1049586466 8:143434760-143434782 GGGGGCCCACGATGACTTCCTGG - Intergenic
1053298857 9:36934670-36934692 GGGAATCCATGAGGGCTTCCTGG - Intronic
1056818115 9:89816387-89816409 TGGGCTCCAAGAGCACATCTAGG + Intergenic
1057905073 9:98976878-98976900 GGGAATCCAAGAAGACTTCATGG + Intronic
1058910898 9:109518978-109519000 GGGGCTCCAGGAAGTCTTCCTGG - Intergenic
1059357237 9:113709461-113709483 GGGAATCAAGGAGGACTTCCTGG + Intergenic
1059421807 9:114196882-114196904 GGTGCTCCAGGAGGACTTCCTGG - Intronic
1059425526 9:114218663-114218685 GTCAATCCAAGAGGACTTCCTGG + Intronic
1059696321 9:116733423-116733445 GGGGCTCGGAGAGGACCCCCCGG + Exonic
1060330999 9:122670196-122670218 GGGTGTCCAAGTGGATTTCCAGG - Intergenic
1060816151 9:126636302-126636324 GGGGCTGGAAGAGGGCTTCCTGG + Intronic
1061386633 9:130294529-130294551 GAGGCACCAAGAGGGCTTCCTGG + Intronic
1062400028 9:136368347-136368369 GGGGCTCCCACGGGACTTCCCGG - Intronic
1062467820 9:136688884-136688906 GGGGTCCCAGGTGGACTTCCTGG + Intergenic
1062485235 9:136771206-136771228 GGGCGTCCAACAGGACTTTCCGG + Intergenic
1190535364 X:51421213-51421235 GGGGATTCAAGGGGACTCCCTGG + Intergenic
1191666640 X:63709232-63709254 AGCACTCTAAGAGGACTTCCAGG - Intronic
1191958199 X:66669379-66669401 GGGGCACAAGGAGGACTTCTAGG - Intergenic
1192495747 X:71615854-71615876 TGGGCTCCAGGGGCACTTCCTGG - Intergenic
1192796381 X:74427013-74427035 GGGTCTCCAAGAGAACTCCCTGG + Intronic
1194671013 X:96732858-96732880 GGGGCACAAAGAGGACATCATGG + Intronic
1194995107 X:100583370-100583392 GGAGCTCCAAGAGAACAGCCTGG + Intergenic
1197865227 X:131010149-131010171 GGGACTCCTTGAGGACTTCTTGG + Intergenic
1198261898 X:134972559-134972581 GGGGATATAAGAAGACTTCCTGG + Intergenic
1199720872 X:150542064-150542086 GTGGCCCCAAGAGGGCCTCCTGG + Intergenic
1199793825 X:151177436-151177458 GGGGCTCCAGGACGGCTCCCGGG + Intronic
1200399403 X:156010337-156010359 TGGGCTGCATGAGGACCTCCAGG + Exonic