ID: 1062812068

View in Genome Browser
Species Human (GRCh38)
Location 10:474484-474506
Sequence GGGGCTCCAAGAGGACTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062812068_1062812080 10 Left 1062812068 10:474484-474506 CCTGGAAGTCCTCTTGGAGCCCC No data
Right 1062812080 10:474517-474539 CCAAACGTGCTACCGTCACTGGG No data
1062812068_1062812078 9 Left 1062812068 10:474484-474506 CCTGGAAGTCCTCTTGGAGCCCC No data
Right 1062812078 10:474516-474538 CCCAAACGTGCTACCGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062812068 Original CRISPR GGGGCTCCAAGAGGACTTCC AGG (reversed) Intronic