ID: 1062812880

View in Genome Browser
Species Human (GRCh38)
Location 10:478817-478839
Sequence TCGCGTGTCCGGGCGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062812874_1062812880 -4 Left 1062812874 10:478798-478820 CCCATCTTATTCTCACTCATCGC 0: 1
1: 1
2: 5
3: 8
4: 120
Right 1062812880 10:478817-478839 TCGCGTGTCCGGGCGTGCTGGGG No data
1062812872_1062812880 21 Left 1062812872 10:478773-478795 CCAGGCGTGCAGATACATCCAAA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1062812880 10:478817-478839 TCGCGTGTCCGGGCGTGCTGGGG No data
1062812873_1062812880 3 Left 1062812873 10:478791-478813 CCAAATTCCCATCTTATTCTCAC 0: 2
1: 3
2: 2
3: 29
4: 399
Right 1062812880 10:478817-478839 TCGCGTGTCCGGGCGTGCTGGGG No data
1062812875_1062812880 -5 Left 1062812875 10:478799-478821 CCATCTTATTCTCACTCATCGCG 0: 2
1: 1
2: 1
3: 5
4: 69
Right 1062812880 10:478817-478839 TCGCGTGTCCGGGCGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062812880 Original CRISPR TCGCGTGTCCGGGCGTGCTG GGG Intronic
No off target data available for this crispr