ID: 1062814034

View in Genome Browser
Species Human (GRCh38)
Location 10:486352-486374
Sequence CTTGCTTCCCAGTCGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062814034_1062814043 23 Left 1062814034 10:486352-486374 CCTCCTGCCGACTGGGAAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1062814043 10:486398-486420 CTCTGGCACATAGTGAATGCGGG 0: 1
1: 0
2: 0
3: 21
4: 185
1062814034_1062814042 22 Left 1062814034 10:486352-486374 CCTCCTGCCGACTGGGAAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1062814042 10:486397-486419 TCTCTGGCACATAGTGAATGCGG 0: 1
1: 0
2: 1
3: 12
4: 153
1062814034_1062814039 6 Left 1062814034 10:486352-486374 CCTCCTGCCGACTGGGAAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1062814039 10:486381-486403 TCTGCCTCCAGATGTTTCTCTGG 0: 1
1: 0
2: 0
3: 21
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062814034 Original CRISPR CTTGCTTCCCAGTCGGCAGG AGG (reversed) Intronic
900292651 1:1930024-1930046 CCTGCTTCCCAGCCTGCATGTGG + Intronic
900745261 1:4356483-4356505 CTTGCTTCCCATGCAGCACGTGG - Intergenic
900846526 1:5107340-5107362 ATTGCAGCCCAGTGGGCAGGCGG + Intergenic
901833486 1:11908563-11908585 CTTGCTGCCCTGACAGCAGGCGG - Intergenic
901901339 1:12366010-12366032 CTAGCTACTCAGTAGGCAGGAGG - Intronic
903814882 1:26057638-26057660 GTTGCTTGGCAGTCTGCAGGGGG + Exonic
907284004 1:53368812-53368834 CCTGCTGCCCAGTCCGCTGGCGG + Intergenic
907406984 1:54259671-54259693 CCTCCTCCCCAGTGGGCAGGCGG - Intronic
911533576 1:99075064-99075086 CTCACTTCCCAGACGGCATGGGG - Intergenic
913997318 1:143661977-143661999 CTTGCTTCCAAGTCTGGAGGCGG + Intergenic
914193689 1:145432198-145432220 CTTGCTTCCAAGTCTGGAGTTGG + Intergenic
914475018 1:148015088-148015110 CTTGCTTCCAAGTCTGGAGTTGG + Intergenic
914507684 1:148303537-148303559 CTTGCTTCCAAGCCTGGAGGTGG + Intergenic
917329593 1:173868209-173868231 CTTCCTCCTCAGTCGGGAGGAGG - Intronic
920590818 1:207216898-207216920 CTTGATTGCCAGTTGGCTGGTGG + Intergenic
920728739 1:208462701-208462723 CTTGCTTCTCAGTCTGCTTGTGG + Intergenic
921519112 1:216137519-216137541 CTTGCTCCTCGGTCTGCAGGCGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
1062814034 10:486352-486374 CTTGCTTCCCAGTCGGCAGGAGG - Intronic
1067906903 10:50301407-50301429 TTTGCTTCCCATTTAGCAGGTGG - Intergenic
1070810333 10:79294413-79294435 CTCACTTCCCAGAGGGCAGGAGG - Intronic
1072966329 10:99975961-99975983 ATTGGTTCCCATTTGGCAGGTGG + Intronic
1075643719 10:124084188-124084210 CTTGCTTCCCAGCCAGCGCGTGG - Intronic
1075889612 10:125935415-125935437 CTTACTTCCTAGTTGCCAGGTGG + Intronic
1078772714 11:14365668-14365690 CTTGCTCCTCAGCCTGCAGGTGG - Intergenic
1081569371 11:44280061-44280083 CTTTCTCCCCAGTGGGTAGGAGG - Intronic
1084321841 11:68377620-68377642 GTGGCTTCCCAGCTGGCAGGCGG - Intronic
1085928992 11:81058091-81058113 CTTGCTCCTCAGTCTGCAGAAGG - Intergenic
1087041378 11:93804116-93804138 CTTGCTTCTCAGCCGGCAGATGG - Intronic
1087336467 11:96850824-96850846 CCTTCTTCCCAGGCAGCAGGAGG - Intergenic
1088191330 11:107232018-107232040 CTTGCTTCTCAGCCTGCAGACGG - Intergenic
1090040583 11:123287518-123287540 GTTGCTTCCTTGTTGGCAGGAGG + Intergenic
1090110272 11:123900042-123900064 GTTTCTTCCCAGTGGGCAGGAGG + Intergenic
1090207616 11:124894614-124894636 CGTGCTTCCAAGTCACCAGGGGG + Intronic
1092083397 12:5736382-5736404 CTTGCTTCCCAGGGGAAAGGAGG - Intronic
1092255675 12:6925784-6925806 CTTCCTTCCCTGAAGGCAGGTGG + Intronic
1095976508 12:47943870-47943892 CCTGCTTCCCAGAGGGCATGGGG - Intergenic
1096934372 12:55255255-55255277 TTTGCCTCCCAGTCCCCAGGGGG - Intergenic
1101697995 12:107144766-107144788 CATGCCTCCTCGTCGGCAGGAGG + Intergenic
1103586618 12:121961037-121961059 CTTGCCTCCCAGTGTGCACGGGG + Intronic
1103935374 12:124473500-124473522 CTTGCTTCTCAGCCTGCAGATGG + Intronic
1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG + Intergenic
1104795318 12:131512998-131513020 CTTGCTCCTCAGTCTGCAGACGG + Intergenic
1104950575 12:132438053-132438075 CTTGATTCCCAGGCTGCAGTTGG - Intergenic
1104950590 12:132438129-132438151 CTTGATTCCCAGGCTGCAGTTGG - Intergenic
1106102663 13:26708098-26708120 CTGGCTGCCCAGTCCCCAGGTGG + Intergenic
1108862141 13:54874130-54874152 CTTGCTTCCCAGTAGGCTGAAGG + Intergenic
1112308139 13:98293792-98293814 CTTTCTTCCCAGTGGGCAGGAGG - Intronic
1112616065 13:101006797-101006819 CTTGCTCCTCAGCCTGCAGGTGG - Intergenic
1113078355 13:106491053-106491075 CTTGTTTCCCAGAAGGGAGGGGG + Exonic
1113335048 13:109369675-109369697 CCAGCTTCCCACTCGGGAGGTGG - Intergenic
1113379888 13:109794349-109794371 CTTGCTTCCCGGGCAGCATGGGG - Intergenic
1116414590 14:44665259-44665281 CTTGCTTCTCAGTATGCAGATGG + Intergenic
1118785075 14:69038880-69038902 CTTGCTTCACAGTGGGAAAGGGG - Intergenic
1119137797 14:72236778-72236800 CTCACTTCCCAGATGGCAGGGGG + Intronic
1122362274 14:101174533-101174555 CTGCCTTCCCAGCCTGCAGGTGG + Intergenic
1122600246 14:102917766-102917788 CTTGCTTCTCAGTGGGAAGGAGG - Intergenic
1125105106 15:35961667-35961689 CTTCCTTGCCAGTGGGCATGAGG - Intergenic
1126283233 15:46980806-46980828 CTTGCTTCCCAGCTTGCAGATGG + Intergenic
1129205372 15:74034374-74034396 CTTGCAGGCCAGTCGGCTGGGGG - Intronic
1129221865 15:74135872-74135894 TTTGGTTCCCTGCCGGCAGGAGG - Exonic
1130666552 15:85874239-85874261 CTTCCTTCCCAGTGGGGAGTGGG + Intergenic
1132788145 16:1669667-1669689 CTTGCTACCCAGTGGGCAAACGG - Intronic
1133966848 16:10537856-10537878 CTCCCTTCCCAGCCGCCAGGAGG - Intronic
1135860303 16:26050094-26050116 CCCGCTTCCCAGTCTCCAGGGGG - Intronic
1135939412 16:26808360-26808382 CTTTCTTCCCAGACAGCAGCAGG - Intergenic
1137564857 16:49526588-49526610 CCTGCTTCCCGGGCTGCAGGAGG + Intronic
1141980438 16:87546977-87546999 CTAGCTTTCCAGCAGGCAGGGGG + Intergenic
1143938523 17:10513131-10513153 CTTTTTTCCCAGGAGGCAGGAGG - Intronic
1145247441 17:21278829-21278851 CTTCCTGCCCAGCAGGCAGGAGG - Intergenic
1146837290 17:36122193-36122215 CTTGCTTCTCAGCCTGCAGATGG - Intergenic
1148952520 17:51326070-51326092 CTTGCTCCTCAGTTTGCAGGTGG + Intergenic
1150229739 17:63543561-63543583 CTTGCTTCCCATAAGGCAGCCGG + Exonic
1151795619 17:76343318-76343340 CTTGCTTCCCTCAGGGCAGGGGG - Intronic
1154415786 18:14174565-14174587 CTTGCTTCTCTGTGGGCTGGTGG - Intergenic
1157359496 18:46964500-46964522 CTCGCTGCCCGGTCGCCAGGCGG + Intronic
1157361090 18:47024019-47024041 CTCGCTGCCCGGTCGCCAGGCGG + Intronic
1157362080 18:47029934-47029956 CTCGCTGCCCGGTCGCCAGGCGG + Exonic
1162469340 19:10863070-10863092 ATTGCTTCCCTGTGGGCTGGGGG + Intronic
1162519909 19:11173687-11173709 CTTCCTTCCCAGTCTGGTGGGGG - Intronic
1163119609 19:15209329-15209351 CTGGCTTCTCAGAGGGCAGGAGG + Intergenic
1164005441 19:21144236-21144258 CTTGCTGCCCAGGCTGCAGAAGG + Intronic
1168497413 19:56864994-56865016 CCTGTTTCCCAGTCGGCCGTGGG - Intergenic
926041216 2:9674716-9674738 CATGCTTCCCAGAAGGGAGGAGG + Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
928603764 2:32925549-32925571 CCTGCATCCCAGCCGGCAGAAGG + Intergenic
932685591 2:73866661-73866683 CTTTCTTTCCAGCCGCCAGGAGG + Exonic
935564731 2:104593650-104593672 CTTGCTTCTCAGCCTGCAGATGG - Intergenic
936344523 2:111665165-111665187 CATGCCTCCCGGTGGGCAGGTGG - Intergenic
938144141 2:128820104-128820126 CTTGCTTCTCAATATGCAGGAGG - Intergenic
940165309 2:150764307-150764329 CTGGCTTCCCAGTTGGAAGGTGG - Intergenic
941744453 2:169071644-169071666 CCTGCTTCCCTGAGGGCAGGAGG - Intronic
945584843 2:211647813-211647835 CTTGCTTCCCAATCAGCATATGG + Intronic
946967746 2:225055791-225055813 CTTGCTTCCCAGCTGGAGGGTGG - Intergenic
947605103 2:231481037-231481059 CTGGGTTCCAAGTGGGCAGGGGG + Intronic
1172894901 20:38293643-38293665 CTTGTTTTCTAGTGGGCAGGAGG + Intronic
1174994391 20:55549757-55549779 CTTGCTTCCCGATGGGGAGGTGG - Intergenic
1175735472 20:61383940-61383962 CTTGCTTCTCAGCCTGCAGATGG - Intronic
1175758985 20:61548356-61548378 CTTACTTCCAAGTCAGAAGGTGG - Intronic
1181690425 22:24555866-24555888 CTAGTTTCCCAGCCGGCAGGCGG + Exonic
1182434005 22:30318577-30318599 CTTGCTTCCCTGTAGCCAGAGGG + Intronic
1184885440 22:47342282-47342304 CCTGCTCCCCAGTAGACAGGGGG - Intergenic
1185344736 22:50306302-50306324 CTTGCTTCTCAGTCGGCTCTGGG + Intronic
950262771 3:11554425-11554447 CTTGCCTTCCAGAGGGCAGGTGG + Intronic
950522465 3:13505216-13505238 CCTGGTTCCCAGGCAGCAGGTGG + Exonic
950688457 3:14636205-14636227 CTTGCTTCCCGGTTTGCAGATGG - Intergenic
953851738 3:46470066-46470088 CTTGCTCCCCAGTGGGCAAGGGG + Intronic
954776555 3:53024216-53024238 CTTGCTTCCAAGTCTGGAGGTGG + Intronic
955012909 3:55036954-55036976 CCTGATTCCCAGTGGCCAGGAGG + Intronic
955338176 3:58104151-58104173 GTTGCTTCCCGGGCTGCAGGAGG + Intronic
959511743 3:107220668-107220690 CTTGCTTCCCAGTCAGATGCGGG - Intergenic
961099545 3:124186894-124186916 CTTGTTTGCCAGTTGGGAGGAGG + Intronic
962965798 3:140353311-140353333 CTTGCTTCTCAGCCTGCAGATGG - Intronic
965034678 3:163423260-163423282 CTTGCTCCTCAGTCTGCAGTTGG - Intergenic
969115911 4:4870745-4870767 CTTGCTTCCCAGTTGCCGGTCGG - Intergenic
969431957 4:7160566-7160588 CTTGCTTTCCAGTCAGCACAGGG + Intergenic
971043054 4:22776643-22776665 CTTGCTTCTCAGCCTGCAGAGGG - Intergenic
976949512 4:90812054-90812076 CTTGCTTCTCAGCCTGCAGATGG - Intronic
977638283 4:99326131-99326153 CTTACTTCCATGTGGGCAGGAGG + Intergenic
985881153 5:2640209-2640231 CTTCTTCCCCAGGCGGCAGGAGG + Intergenic
987957398 5:24758078-24758100 CTTGCTTCTCAGCCTGCAGATGG + Intergenic
989754248 5:44933737-44933759 TTTGCTTTGCAGTCGGCATGAGG + Intergenic
990747321 5:58972515-58972537 CTTACTTTCCAGTCCCCAGGAGG + Exonic
990973471 5:61535654-61535676 CATGCTTCCCAGTGGGAATGTGG - Intronic
994975724 5:106802624-106802646 CTTGCTTCTCAGCCTGCAGATGG - Intergenic
996018909 5:118570606-118570628 CTTGCTCCTCAGTTTGCAGGTGG + Intergenic
996508216 5:124290968-124290990 CTTGAGTCCCTGTGGGCAGGGGG - Intergenic
1000193793 5:158938613-158938635 CTCTCTTCCCAGTCTGCAGAGGG + Intronic
1001362614 5:171103146-171103168 CTCTCTTCCAAGCCGGCAGGCGG + Intronic
1006450734 6:34104308-34104330 CATCCTTGCCAGTGGGCAGGAGG + Intronic
1014594599 6:123318675-123318697 CTTGCTTCCCACTCTGCACACGG + Intronic
1017528629 6:155265849-155265871 CTTGCTTCTCAGCCTGCAGATGG - Intronic
1018599433 6:165524124-165524146 CTTGCTCCTCAGCCGGCAGAGGG + Intronic
1021044962 7:15911573-15911595 CTGACTTCCCAGTAGGCAGAGGG + Intergenic
1023052826 7:36267951-36267973 CTCACTTCCCAGTCTGCAGATGG - Intronic
1027256032 7:76431254-76431276 CAGGCTGCCCAGTCGGCATGAGG + Intronic
1028141317 7:87278581-87278603 CTTGCTCCTCAGTCTGCAGATGG + Intergenic
1028293616 7:89099424-89099446 GCTGCTTCCCAGTGAGCAGGTGG - Intronic
1028639841 7:93029708-93029730 CTTGCTTCTCAGCCTGCAGATGG + Intergenic
1031196892 7:118627189-118627211 CTGGCTTGCCAGGCTGCAGGTGG + Intergenic
1035685347 8:1519953-1519975 CTCGGTTTCCAGTCTGCAGGAGG + Intronic
1045509602 8:102804748-102804770 CTTGCCTCCCAGTGGGCTGCTGG + Intergenic
1048869203 8:138783358-138783380 CTTGCTTCTCAGCCTGCAGATGG - Intronic
1049544134 8:143221674-143221696 CGCGCTCCCCAGACGGCAGGCGG - Intergenic
1058826111 9:108777411-108777433 TATGCTTCCCAGCCTGCAGGTGG + Intergenic
1059829962 9:118084558-118084580 CTTGCTTCCCAGCTTGCAGACGG - Intergenic
1186381665 X:9067355-9067377 CCTTCTTCACAGGCGGCAGGAGG + Intronic
1186939020 X:14484025-14484047 CTTGCTTCTCAGCCTGCAGACGG + Intergenic
1193464839 X:81835830-81835852 CTTGCTTCTCAGCCTGCAGATGG - Intergenic
1199160677 X:144607406-144607428 CTTGGTTCCCAGTCAGCCAGGGG + Intergenic
1199499987 X:148498416-148498438 CTTTCTTCCCAATCAGCAGGAGG - Intergenic