ID: 1062816051

View in Genome Browser
Species Human (GRCh38)
Location 10:500831-500853
Sequence CTGAAGCCTGAAACCTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062816051 Original CRISPR CTGAAGCCTGAAACCTATGG GGG (reversed) Intronic
901011900 1:6206879-6206901 CCGAAGCCTGCAACTTCTGGCGG - Intronic
902395523 1:16130472-16130494 CTGCAGCCTCCAGCCTATGGAGG + Intronic
906476746 1:46174506-46174528 GTGAACCCTGAGACCTTTGGTGG - Intronic
908580480 1:65510931-65510953 CTGAGGACTGAACCCTCTGGGGG + Intronic
916738398 1:167628293-167628315 GTGAAGCCAGAAACCTGTGCTGG + Intergenic
920591349 1:207221803-207221825 CAGAAGCATGAAAACTATTGAGG + Intergenic
1062816051 10:500831-500853 CTGAAGCCTGAAACCTATGGGGG - Intronic
1070216263 10:74384737-74384759 GTGAAACCTGAAACCTAAGTAGG + Intronic
1070384052 10:75907981-75908003 CTGAAGCCTGTCATCCATGGTGG + Intronic
1072158673 10:92746647-92746669 CTCCAGCTTGAAAACTATGGTGG - Intergenic
1073662889 10:105496908-105496930 CTGGAGCCTGGATTCTATGGAGG - Intergenic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1076491055 10:130861998-130862020 CAGAGGCCTGAAACCCAGGGTGG + Intergenic
1078785687 11:14489978-14490000 ATGAAGTCTGAAAAATATGGAGG - Intronic
1079127567 11:17729960-17729982 CTGAAGCCTGGAAGTTTTGGGGG - Intergenic
1080819594 11:35792772-35792794 CTGAAGCCCTGAACCTCTGGAGG + Intronic
1081192329 11:40119277-40119299 CTGAAGCCAGAAAGCAATGGAGG - Intronic
1083008013 11:59367291-59367313 CTGAAGACTGAAAGCCCTGGTGG - Intergenic
1083333446 11:61909706-61909728 CCGCAGCCTGAGAGCTATGGCGG + Intronic
1085586955 11:77717552-77717574 CTGAATACTGAAACCTAAGAAGG + Intronic
1086043354 11:82504219-82504241 CAGAAGTCAGAGACCTATGGTGG - Intergenic
1087693583 11:101350077-101350099 CTGACCCCTCAAACCTTTGGAGG - Intergenic
1096505701 12:52091237-52091259 CTGAAACCTGAAACCCGTGATGG - Intergenic
1098873265 12:75840371-75840393 CTGAAGCCTCCAAACTGTGGGGG + Intergenic
1099752491 12:86794428-86794450 CTGAAGCATGAAATCTGTTGTGG - Intronic
1099862565 12:88238699-88238721 CAGAAGCCTGGAGCCTCTGGGGG + Intergenic
1100793132 12:98152467-98152489 CAGACTCCTGAAACCTATGGGGG + Intergenic
1103281040 12:119758096-119758118 CTGAAGAGAGAAACCTAAGGGGG + Intronic
1104372680 12:128237443-128237465 CTGAAGACAGAAGCCCATGGAGG - Intergenic
1105585707 13:21741040-21741062 CTGAAGCTTGAAACCAGAGGTGG - Intergenic
1106134080 13:26961413-26961435 CAGAATCCTGAAAGCTGTGGTGG + Intergenic
1107188074 13:37547274-37547296 CTCAAGCCTGAAGGCTATGGAGG + Intergenic
1109518501 13:63476662-63476684 CTGAGGCCAGCAAACTATGGAGG - Intergenic
1114600915 14:23954767-23954789 ATGAAGCCTGTCACCCATGGTGG + Intronic
1114610594 14:24037479-24037501 ATGAAGCCTGTCACCCATGGTGG + Intergenic
1115507299 14:34104690-34104712 CTGCAGCCTGAACCATCTGGAGG + Intronic
1115653058 14:35417111-35417133 CTGCACCCTGAAAGCTGTGGTGG + Intergenic
1120273235 14:82341031-82341053 TTGAAACCTGAAACACATGGTGG + Intergenic
1125281735 15:38048845-38048867 CTGAAGACTGAAAAATATGTGGG - Intergenic
1127013775 15:54659931-54659953 AAGAAGCCTGAAAGCTAAGGAGG + Intergenic
1127798411 15:62457395-62457417 CTGAAGCCCTAAACCCAAGGGGG - Intronic
1135557361 16:23448164-23448186 ATGAAGCTTTAAACCTATGAAGG + Intronic
1140922180 16:79549672-79549694 CCGAAGCCTGACACCAATGTGGG + Intergenic
1144049622 17:11487328-11487350 CTAAAGCCTGAAAGTTAGGGTGG + Intronic
1144300100 17:13915406-13915428 CTGAAGTCTGATACTTTTGGGGG + Intergenic
1149540223 17:57463007-57463029 CTTAATCCTGAGACCTGTGGTGG - Intronic
1149579087 17:57735893-57735915 CTGATGCCTGCCACCTGTGGAGG + Intergenic
1150430401 17:65111279-65111301 CTGAGGCCTTAAATCTGTGGAGG - Intergenic
1151698591 17:75730765-75730787 CTGAGGCCTGGAACCTACTGTGG - Intronic
1151885921 17:76923394-76923416 CTGAACCCTGAATCCTGGGGAGG + Intronic
1157365879 18:47063999-47064021 TTGAAGACTGAAACCTAGGCAGG + Intronic
1164507904 19:28874526-28874548 CTGAAGCCCGAGACCTAGGCTGG + Intergenic
1167711871 19:51116671-51116693 CTGGAGCCTGAGACCTCTCGGGG + Intergenic
1168577741 19:57527423-57527445 CTGGAGCCGGAAACCGGTGGAGG + Exonic
925744767 2:7034485-7034507 CGGAAGCCTGAAAACTAGGCAGG - Intronic
925875477 2:8308082-8308104 ATGGAGCCTGAAACCTATTCTGG + Intergenic
926223685 2:10952619-10952641 CAGAGACCTGAGACCTATGGTGG + Intergenic
929218635 2:39440915-39440937 CCTAAGCCAGAAACCCATGGGGG - Intergenic
930772401 2:55141324-55141346 CTAACCCCTGGAACCTATGGAGG - Intergenic
930919020 2:56728612-56728634 CTTAAGTCTGATACCTTTGGAGG + Intergenic
932508621 2:72262393-72262415 CTGAAGTCTCAAACTTATTGAGG + Intronic
936377460 2:111954146-111954168 CTGAAGTCTGAGACCCATTGGGG + Intronic
942688373 2:178558547-178558569 CTGAAGCCTGAACATGATGGCGG - Exonic
946881924 2:224185154-224185176 CTGAATGCTGAAACCAAGGGAGG + Intergenic
948257162 2:236576980-236577002 CTGACCCCTGGAACCTTTGGTGG + Intronic
948461989 2:238134264-238134286 CTGAGGCCTGGAGGCTATGGAGG - Intergenic
1172507601 20:35475118-35475140 CTGAAGCCTCAAACTCCTGGGGG - Intronic
1175837476 20:62005256-62005278 CTGCACCCTGAAGCCTGTGGAGG - Intronic
1179560145 21:42210686-42210708 CAGATGCCTGGAAGCTATGGTGG - Intronic
1183814006 22:40283712-40283734 GAAAAGCCTAAAACCTATGGTGG + Intronic
1185125625 22:49009160-49009182 CTGAAGCCTGAGACCAAGGTGGG + Intergenic
950654947 3:14430782-14430804 CTGAGGCCTGAAAGATGTGGTGG - Intronic
953060818 3:39427593-39427615 CTGAAGCCTGAAAATGATGCTGG - Intergenic
955248482 3:57252088-57252110 CTGCATCCTGATACCTCTGGTGG + Intronic
966538187 3:181058092-181058114 ATGAAGACTGATACCTTTGGTGG - Intergenic
968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG + Intronic
970405998 4:15765008-15765030 CTGAAGCCTGAAGCCCAGAGAGG - Intergenic
971217430 4:24674174-24674196 CTGAAGCCAGGAACCTGTAGGGG - Intergenic
972101364 4:35423021-35423043 CTGAATCCTGATACCTGTGGTGG - Intergenic
974780141 4:66543863-66543885 CTGAAGCCAGCAACTTTTGGAGG - Intergenic
975999288 4:80353640-80353662 GTGAAGCTTGAAATCTGTGGAGG + Intronic
981391527 4:144196826-144196848 CTGAAGCCTGAGACATATCTGGG - Intergenic
983769788 4:171535146-171535168 CTGAAGCCAAACACCTAAGGCGG - Intergenic
984358509 4:178696680-178696702 CTGCAGCCTGGAACCTCTGGAGG + Intergenic
986838719 5:11671933-11671955 CTGAAGTCAGTGACCTATGGAGG + Intronic
988619930 5:32812513-32812535 CTGAGTCCTGAAACCTCTGTTGG + Intergenic
988683004 5:33502156-33502178 CTGAAGCCTGGATGCTAGGGCGG - Intergenic
989194008 5:38698447-38698469 TTGAAGCCTGAACCCTAATGTGG - Intergenic
992007251 5:72490110-72490132 TTGAAGCCTGGAACTTGTGGAGG - Intronic
992910113 5:81388316-81388338 GTGAAGCCAGGACCCTATGGTGG - Intronic
993457938 5:88146012-88146034 CTGAACCCTGAAAGCCCTGGCGG + Intergenic
993643867 5:90438593-90438615 CTGAACCCTGACAACAATGGAGG + Intergenic
994743115 5:103645867-103645889 CTCATGTCTGAATCCTATGGAGG + Intergenic
1000614576 5:163413095-163413117 CAGAAGCCTGAAACCTAGGTCGG - Intergenic
1005344336 6:24874524-24874546 CTGAAACCTGAAAGCTCTGTTGG + Intronic
1014069932 6:117169089-117169111 CTGAAGCCTGAGAAGGATGGTGG - Intergenic
1015234320 6:130953389-130953411 CTGAAACCTAATCCCTATGGTGG + Intronic
1015899871 6:138053352-138053374 CTGAAGCCATAAACCCATGAAGG + Intergenic
1021109702 7:16679515-16679537 CTGAAGTCTGAAGCCCATAGAGG + Intronic
1022644740 7:32219661-32219683 CTGCAGCCTGATGCTTATGGTGG - Intronic
1023723388 7:43117925-43117947 CTGAAGCTTGATGCATATGGAGG + Intronic
1023847312 7:44129738-44129760 CTGAGGCCTGAAGCCCGTGGAGG + Intergenic
1027252826 7:76409783-76409805 CTGAAACCTGAACCCTGGGGTGG - Intronic
1027659453 7:80971467-80971489 CTGAAACCAGAACCCAATGGGGG - Intergenic
1028888165 7:95957668-95957690 CTGCAGCCTGAAGCCTTTGTTGG + Intronic
1037237769 8:16740869-16740891 CTGCAAGCTGAAAGCTATGGGGG - Intergenic
1037614733 8:20508509-20508531 CTGAAGCCTGACACCGGTGGGGG + Intergenic
1038103245 8:24404042-24404064 CTGAAGCCTGGAACTGATTGCGG + Exonic
1038112790 8:24517950-24517972 CTGCAGCCTGAAAACTCTGAAGG + Intronic
1040566404 8:48571636-48571658 CTCCAGCCTGAGACCTACGGAGG - Intergenic
1045799189 8:106081897-106081919 CTGATGTCTGAAACCCATAGAGG - Intergenic
1047818855 8:128495932-128495954 CTGAAGGTAAAAACCTATGGTGG - Intergenic
1052342964 9:27381039-27381061 CAGGAGCCTGAAACCTAGAGAGG - Intronic
1055760060 9:79597641-79597663 CTCAAGCCAGAAACCCATAGAGG + Intronic
1058556978 9:106179563-106179585 CTAAAGCATGAAACCTGTGAAGG - Intergenic
1060282905 9:122226081-122226103 CTGAAGCCTGAGACTTAGGCAGG + Intronic
1060555809 9:124506719-124506741 CTGGAACCTGGAACCTGTGGGGG - Intronic
1061153414 9:128842565-128842587 CTGAAGCCTGACAGCTGTGTGGG + Intronic
1190230209 X:48575988-48576010 CTGAAGCCTCAAACCAAGAGAGG + Intronic
1192489299 X:71560409-71560431 ATTAAGATTGAAACCTATGGGGG + Intronic
1193739880 X:85204069-85204091 CTGAAGACTGAAGGCTCTGGTGG + Intergenic
1199855616 X:151756591-151756613 TAGAAGCCTGAAACATAGGGAGG - Intergenic
1199987304 X:152962056-152962078 CTGAGACCTGAAACATCTGGAGG + Intronic