ID: 1062820017

View in Genome Browser
Species Human (GRCh38)
Location 10:527930-527952
Sequence CTACATAATTACGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062820017_1062820021 -7 Left 1062820017 10:527930-527952 CCCAGCTCCACGTAATTATGTAG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1062820021 10:527946-527968 TATGTAGATTAGGTAAATGATGG No data
1062820017_1062820025 27 Left 1062820017 10:527930-527952 CCCAGCTCCACGTAATTATGTAG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1062820025 10:527980-528002 CTAAGCCTCCCCCGCCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062820017 Original CRISPR CTACATAATTACGTGGAGCT GGG (reversed) Intronic
903489868 1:23720110-23720132 CTTCATAATGACCTGGGGCTAGG - Intergenic
905917678 1:41697142-41697164 CTACAGAATTAAGTGGGGCAAGG - Intronic
916662536 1:166935717-166935739 CTAAATAATTAAGTGGTTCTGGG + Intronic
923225697 1:231937261-231937283 CTAGATATTTAGGAGGAGCTAGG - Intronic
923783639 1:237047544-237047566 CTAGATAATTACATGGAGAGGGG - Intronic
924000397 1:239544219-239544241 CTGCATGATTACTAGGAGCTAGG - Intronic
1062820017 10:527930-527952 CTACATAATTACGTGGAGCTGGG - Intronic
1065472408 10:26095628-26095650 CAACATAATTTCTTGGACCTTGG - Intronic
1065710622 10:28513698-28513720 ATAAATAATTATGAGGAGCTAGG + Intergenic
1066161052 10:32728412-32728434 GTATATAATTATGTGGAGATGGG - Intronic
1066673842 10:37867245-37867267 TTACATGATCACATGGAGCTTGG - Intergenic
1068080329 10:52311396-52311418 CAACATACTTACATGGGGCTGGG - Intergenic
1073957187 10:108886672-108886694 CTACATAATTACATATATCTCGG - Intergenic
1075256000 10:120926539-120926561 CTCAATAAGTACTTGGAGCTTGG - Intergenic
1077516752 11:3006834-3006856 CTACAAAGTTACCAGGAGCTTGG - Intronic
1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG + Intronic
1089903098 11:122009318-122009340 CCACATAAAAACGTAGAGCTTGG + Intergenic
1092536988 12:9398569-9398591 CTACATAATTAAATAGATCTAGG + Intergenic
1092557687 12:9574740-9574762 CTACATAATTAAATAGATCTAGG - Intergenic
1094513600 12:31113168-31113190 CTACATAATTAAATAGATCTAGG + Intergenic
1105468663 13:20671825-20671847 CTGGATAGTTACATGGAGCTAGG - Intronic
1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG + Exonic
1108434456 13:50388082-50388104 GGACATCATTCCGTGGAGCTGGG - Intronic
1108926214 13:55749324-55749346 CTACATAATTAGGCTGAACTTGG + Intergenic
1111969884 13:94901033-94901055 ATACATATTTACGTGGCACTGGG + Intergenic
1113773901 13:112931318-112931340 CGACGTAATTAAGTGGAGCCTGG - Intronic
1114150484 14:20032901-20032923 ATACATAATTTCATTGAGCTGGG - Intergenic
1135054866 16:19223039-19223061 CTACAGAATGAAGTGGAGCTGGG + Exonic
1137450570 16:48570113-48570135 CCACATGATTACTTGGGGCTGGG + Intronic
1142115574 16:88354438-88354460 CTCCAGAATTAGGTGCAGCTGGG + Intergenic
1146097432 17:29945009-29945031 CTGCATAATTATGTGGAATTTGG - Intronic
1149018868 17:51940379-51940401 CTCCAGATTTCCGTGGAGCTTGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
928342287 2:30455283-30455305 ATACATATTTACTTGGAGATGGG + Intronic
933830793 2:86206601-86206623 CTACATAATTAACTGCAGGTAGG - Intronic
946100833 2:217320226-217320248 TTACATAAATACATGGAGTTAGG - Intronic
1170087445 20:12550276-12550298 CATGATAATTAAGTGGAGCTTGG + Intergenic
967363071 3:188654102-188654124 CCTCATCATTATGTGGAGCTAGG + Intronic
974982619 4:68978799-68978821 CTACAGAATTATGTGGGGTTTGG - Intergenic
974994834 4:69141918-69141940 CTACAGAATTATGTGGGGTTTGG + Intronic
978297002 4:107217142-107217164 CTACATAATTAAGTGGATAATGG - Intronic
981938653 4:150258841-150258863 CTACAGAAGTATGTGGCGCTAGG + Intergenic
984847765 4:184122258-184122280 CAATTTAAATACGTGGAGCTGGG + Intronic
985193297 4:187401124-187401146 CTACAGAGTTGCGTGTAGCTAGG - Intergenic
985830486 5:2224416-2224438 CTAAATAATAACGAGGAGCAGGG + Intergenic
989111309 5:37908776-37908798 CTACATAAATATCTGAAGCTGGG - Intergenic
993314138 5:86377456-86377478 CTATATAATTAGGTGGAACTAGG + Intergenic
996151340 5:120039117-120039139 CGAAATAATTATGTGAAGCTAGG + Intergenic
1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG + Intergenic
1005727844 6:28667216-28667238 CTGCAGAAGAACGTGGAGCTAGG + Intergenic
1006257873 6:32845423-32845445 CTGCATTATCACGAGGAGCTTGG + Exonic
1006712443 6:36086013-36086035 CCACACAATTACGTGGAAATTGG + Intronic
1014980210 6:127937132-127937154 AAACATAATTACATGGGGCTTGG - Intergenic
1026243693 7:68599288-68599310 CTACATAAGTAGATGGAGCCTGG - Intergenic
1027641465 7:80738477-80738499 TTACATAATTAAATGGAGATGGG - Intergenic
1033772791 7:144572011-144572033 CTACTTAATAAATTGGAGCTGGG - Intronic
1036403079 8:8427757-8427779 CTAGAGAATTAGTTGGAGCTAGG - Intergenic
1047719283 8:127624301-127624323 CTACATAATTCGGTTCAGCTGGG - Intergenic
1055472608 9:76628239-76628261 CAAAATAAATACTTGGAGCTGGG - Intronic
1186050944 X:5594563-5594585 TGACAAAATTACATGGAGCTAGG - Intergenic
1193169882 X:78323233-78323255 CTACCTAATTACCAGCAGCTTGG + Intronic
1193910471 X:87300240-87300262 TTACATAATTGCTTGCAGCTAGG - Intergenic
1198071337 X:133151498-133151520 CTACATATTCACTTGGAGCCAGG - Intergenic