ID: 1062820571

View in Genome Browser
Species Human (GRCh38)
Location 10:531630-531652
Sequence GCCCTATGGTGTGGGTTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 128}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062820571_1062820575 -2 Left 1062820571 10:531630-531652 CCGGCAAACCCACACCATAGGGC 0: 1
1: 1
2: 0
3: 3
4: 128
Right 1062820575 10:531651-531673 GCCCTCTACAGTTGTGTGTAAGG No data
1062820571_1062820579 17 Left 1062820571 10:531630-531652 CCGGCAAACCCACACCATAGGGC 0: 1
1: 1
2: 0
3: 3
4: 128
Right 1062820579 10:531670-531692 AAGGAATTCTTGGCCTGTCCTGG No data
1062820571_1062820580 18 Left 1062820571 10:531630-531652 CCGGCAAACCCACACCATAGGGC 0: 1
1: 1
2: 0
3: 3
4: 128
Right 1062820580 10:531671-531693 AGGAATTCTTGGCCTGTCCTGGG No data
1062820571_1062820581 19 Left 1062820571 10:531630-531652 CCGGCAAACCCACACCATAGGGC 0: 1
1: 1
2: 0
3: 3
4: 128
Right 1062820581 10:531672-531694 GGAATTCTTGGCCTGTCCTGGGG No data
1062820571_1062820584 26 Left 1062820571 10:531630-531652 CCGGCAAACCCACACCATAGGGC 0: 1
1: 1
2: 0
3: 3
4: 128
Right 1062820584 10:531679-531701 TTGGCCTGTCCTGGGGTGTGGGG No data
1062820571_1062820578 7 Left 1062820571 10:531630-531652 CCGGCAAACCCACACCATAGGGC 0: 1
1: 1
2: 0
3: 3
4: 128
Right 1062820578 10:531660-531682 AGTTGTGTGTAAGGAATTCTTGG No data
1062820571_1062820582 24 Left 1062820571 10:531630-531652 CCGGCAAACCCACACCATAGGGC 0: 1
1: 1
2: 0
3: 3
4: 128
Right 1062820582 10:531677-531699 TCTTGGCCTGTCCTGGGGTGTGG No data
1062820571_1062820583 25 Left 1062820571 10:531630-531652 CCGGCAAACCCACACCATAGGGC 0: 1
1: 1
2: 0
3: 3
4: 128
Right 1062820583 10:531678-531700 CTTGGCCTGTCCTGGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062820571 Original CRISPR GCCCTATGGTGTGGGTTTGC CGG (reversed) Intronic
900002936 1:24932-24954 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
900022657 1:195457-195479 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG + Intergenic
904454699 1:30640583-30640605 GACCTACAGTGTGGCTTTGCAGG + Intergenic
904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG + Intronic
910331103 1:86072861-86072883 TCCCTCTGCTGCGGGTTTGCTGG - Intronic
911708144 1:101039424-101039446 GCCCTATGGGGTTGGTATGTAGG + Intergenic
912801080 1:112720066-112720088 GCCCTCTGGTGTGGGAATGGGGG + Intergenic
919728593 1:200899216-200899238 GACCTATGGTGGGGGAGTGCAGG - Intronic
921946056 1:220886952-220886974 GACCTACGGTCTGGGTTTGGCGG - Intergenic
924254678 1:242170320-242170342 CCCCTCTGCTGTGGGTCTGCTGG - Intronic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1067562185 10:47311828-47311850 GCCCTCTTGTGTGGGTGTGGTGG - Intronic
1077367169 11:2165957-2165979 GGCCTGGGGTGTGGGTTTGGGGG - Intronic
1079468982 11:20760114-20760136 GCTATATGGTGTGGGTTGGGAGG + Intronic
1083455742 11:62777614-62777636 GCCTCATGGTGTGGTTTTTCTGG + Intronic
1088849775 11:113695304-113695326 GCCCTATGGTGAGACTCTGCTGG - Intronic
1090180774 11:124697314-124697336 GCTCTAAGCTGTGGGTTTGTGGG + Exonic
1091376355 12:26995-27017 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1091750386 12:3018473-3018495 GCCCTGTGGTGTGGGGGTGGGGG - Intronic
1092581575 12:9848856-9848878 GCCCTCTGCTGCAGGTTTGCTGG + Intergenic
1092773053 12:11916006-11916028 GCTCTATGTTCTGGGATTGCTGG + Intergenic
1096073749 12:48789447-48789469 GCCGTGAGGGGTGGGTTTGCGGG - Intergenic
1097888734 12:64756415-64756437 GACCTATGGTGTGATTATGCTGG + Intronic
1104636962 12:130443665-130443687 CACCTAGGGTGTGGGTCTGCAGG + Intronic
1106284664 13:28308293-28308315 GCCCTGTGATGTGGGGTTGAGGG - Intronic
1107792882 13:44019840-44019862 GCCCTAGGGTGAGGGTGTGGAGG + Intergenic
1108747367 13:53409148-53409170 GCCCTGTGGTGTGGGTCTTCTGG + Intergenic
1109837415 13:67877681-67877703 GCCGCTTGGTGTGGGTCTGCAGG + Intergenic
1114431561 14:22666079-22666101 GCCTTCTGCTGTGGCTTTGCAGG + Intergenic
1116511787 14:45755861-45755883 GCCCTCTGCTGCAGGTTTGCTGG + Intergenic
1116715179 14:48417729-48417751 ACCCTCTGGTGAGGCTTTGCTGG + Intergenic
1120818095 14:88884140-88884162 TCCACATGGTGTTGGTTTGCAGG - Intergenic
1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG + Intronic
1122976071 14:105171291-105171313 GCCCGATGGGGTGGGTCAGCAGG - Intergenic
1125248913 15:37676794-37676816 GCCCTATGGGGGGTGATTGCAGG + Intergenic
1128327599 15:66735197-66735219 GGACTATGGTGTGGCTTTGGTGG - Intronic
1128687425 15:69697087-69697109 AGCCTCTGGTGTGTGTTTGCTGG - Intergenic
1132749720 16:1451965-1451987 GCCCTGGGGGGTGGGTTAGCAGG + Intronic
1136575102 16:31118738-31118760 GCCCTATGCTGTGTTGTTGCCGG - Intronic
1138130974 16:54479679-54479701 GCACTGTGGTGAGGGTATGCTGG - Intergenic
1138264946 16:55653883-55653905 GTCCTCTGTTGTGGCTTTGCAGG + Intergenic
1148218393 17:45846340-45846362 GGCCTATGCTGTGGGCCTGCTGG + Exonic
1149299057 17:55287453-55287475 GCCTTATGGTGTTGTTATGCTGG - Intronic
1151439902 17:74121641-74121663 GCCCTATGGAGAGGGTGTGTGGG - Intergenic
1153313316 18:3699395-3699417 GCCCTCTGCTGTAGGTCTGCTGG + Intronic
1153512394 18:5869879-5869901 TCACTATGCTGTGGGTTGGCTGG + Intergenic
1156784459 18:40893334-40893356 GCTCTGTCGTGTGGCTTTGCAGG - Intergenic
1157724610 18:49954435-49954457 GCCCTATCTTGTGGTTCTGCAGG - Exonic
1160634687 19:66540-66562 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1161627271 19:5334609-5334631 GCCCTGGGGTGTGTGTGTGCGGG + Intronic
1162471820 19:10876704-10876726 GCCCTTTGGCGTGGGCTTCCTGG + Intronic
1162771784 19:12953643-12953665 GCCCTATGGTCTGTGCCTGCTGG + Exonic
925064257 2:916876-916898 GCTCTATGCTGTGGATTTGGCGG - Intergenic
925398804 2:3557371-3557393 GCCTTATGGTGCTGGTGTGCTGG - Intronic
926191817 2:10734165-10734187 GCCCTACTGTGTGTGTCTGCTGG + Intronic
927418844 2:22908270-22908292 GCCCTTTGGTGTGGCTGTGAGGG - Intergenic
927931646 2:27049635-27049657 GTCCTGTGGGGTGGGTGTGCCGG - Intronic
936566790 2:113588487-113588509 GCCCTGTGGTGGGGGCGTGCCGG + Intergenic
938151242 2:128885604-128885626 ATACTAAGGTGTGGGTTTGCTGG + Intergenic
938779229 2:134569934-134569956 TGTCTATGGTGTGGATTTGCTGG - Intronic
941439349 2:165514231-165514253 GCCCTATGGTTGGGCTTAGCAGG - Intronic
942958018 2:181796965-181796987 GCCCTCTAGTTTAGGTTTGCTGG - Intergenic
944441146 2:199744656-199744678 GCCCTAGGGAGTGTGTTAGCCGG - Intergenic
947364779 2:229382150-229382172 CCCCTCTGCTGTGGGTCTGCTGG - Intronic
948292364 2:236835288-236835310 GCCCTATTCTGTGGCTCTGCAGG + Intergenic
1168832369 20:853590-853612 GCCAGATGGTGTGGGGCTGCTGG + Intronic
1170834898 20:19875768-19875790 GTCCTTTGGTGTGGGCCTGCAGG + Intergenic
1170845234 20:19956726-19956748 GCCATATGGGGTGGGTGTGGAGG - Exonic
1175110832 20:56646786-56646808 GCCCTGAGGTGGGGGTGTGCTGG + Intergenic
1175621512 20:60451773-60451795 ACCCTATGGTGTGGACTTACTGG - Intergenic
1175782952 20:61695371-61695393 GTCTGATGGTGTGAGTTTGCAGG - Intronic
1176128400 20:63486115-63486137 TCCCTTTTGTGTGGGTTTGAGGG + Intergenic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1177242423 21:18476673-18476695 GCCCCGTGCTGTGGGTTTACAGG + Intronic
1178388902 21:32182404-32182426 GCCCTTTTGTGTGTGTTTGTGGG - Intergenic
1181967724 22:26668464-26668486 GCCCTATTGTCTGGGTCTGGGGG + Intergenic
1182909255 22:33967213-33967235 GCCCTATGTTGTTGGGTTCCTGG - Intergenic
1183509810 22:38228103-38228125 GCCCCATGGTGTGGGCTGCCTGG - Intronic
1183547183 22:38460608-38460630 GCTCCATGGTGTGTGTGTGCAGG - Intergenic
953785053 3:45905203-45905225 GCACTATGGTGTGTCTTGGCTGG - Intronic
954786407 3:53096069-53096091 GCCCTTTAGATTGGGTTTGCTGG - Intronic
957271997 3:78042415-78042437 GGGCTATGGTGTGGGGTTGAGGG - Intergenic
960012655 3:112849996-112850018 GCCCTATGGAGTGGTTTGCCTGG + Intergenic
960399378 3:117177539-117177561 GCCCAAAGTTGTGGGATTGCAGG + Intergenic
963950389 3:151193426-151193448 GCACTGTGGTTTGGTTTTGCTGG + Intronic
966333350 3:178840270-178840292 ACCCTGTGGTGTGGTTCTGCAGG + Intronic
966956404 3:184884767-184884789 ATCCTATCGTGTAGGTTTGCTGG - Intronic
967870541 3:194225474-194225496 GCACAGTGGTGTGGGTTTTCAGG - Intergenic
968581151 4:1396015-1396037 GCCCTGTGGGGTGGGGGTGCTGG + Intergenic
968602598 4:1517391-1517413 CCACCATGGTGTGGGTGTGCCGG - Intergenic
969569343 4:7999579-7999601 GTGCCCTGGTGTGGGTTTGCAGG + Intronic
975320122 4:73000548-73000570 GGGCTAGGGTGTGGGTTTGTGGG - Intergenic
976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG + Intergenic
977632879 4:99263068-99263090 GCCCTCTGGTGCAGGTCTGCTGG + Intergenic
983163965 4:164451993-164452015 GCCTTCTGGTGTGGGTATGGTGG - Intergenic
986136201 5:4980883-4980905 GCCCTATGTTGTGACTTTGGTGG + Intergenic
990344517 5:54858350-54858372 TCCCTCTGGTATGAGTTTGCAGG - Intergenic
990381107 5:55222687-55222709 GCCCTATGCTGTGGTGTGGCAGG - Intronic
994613723 5:102077924-102077946 GCGCTAGGGTGTGGGTAGGCTGG - Intergenic
997523596 5:134538700-134538722 GCCCTAGGGTGGGAGTTTTCAGG - Intronic
1001776088 5:174330128-174330150 ACCGTGTGGTGTGTGTTTGCTGG + Intergenic
1007279741 6:40702547-40702569 GCGCTATGGGGTGGGGTGGCTGG - Intergenic
1007683595 6:43651195-43651217 ACCCTATGGAGTTGGTTTCCAGG + Intronic
1008907920 6:56699993-56700015 TCCCTATGGTATAGGTTTGGGGG - Intronic
1013373012 6:109486545-109486567 TTCCTATGGTATGGGTTTGTTGG - Intergenic
1017047746 6:150363391-150363413 GCCCTGTGATCTGGGTTTGGAGG + Intergenic
1019411804 7:909842-909864 GTCCTATGGTGTGGGGTGGGGGG + Intronic
1019711996 7:2522040-2522062 GCCCTCTTCTGTGGGTTTCCAGG - Intronic
1019922528 7:4172035-4172057 GTCTAAGGGTGTGGGTTTGCAGG + Intronic
1022498284 7:30866714-30866736 GGCCACTGGTGGGGGTTTGCAGG + Intronic
1024190267 7:46999694-46999716 GCCATTTGGTGTGGATTTGTAGG + Intergenic
1024293644 7:47825965-47825987 GCCCTCTGGGGTGGGGTGGCTGG - Intronic
1025776884 7:64568461-64568483 GCCCACAGGTGTGGGCTTGCTGG - Intergenic
1029800786 7:102945543-102945565 GCCCCGTGATTTGGGTTTGCAGG + Intronic
1031512218 7:122664922-122664944 GCATGATGGTGTGTGTTTGCAGG - Intronic
1034894485 7:154867357-154867379 GCCCTGTGGTGTGGATGCGCTGG - Intronic
1034965996 7:155391411-155391433 CCCCGAGGGAGTGGGTTTGCAGG - Intronic
1038280833 8:26162856-26162878 CACCTATAGTGTGGATTTGCTGG - Intergenic
1039952198 8:42181169-42181191 GCCCTTGGGTGTGAGTTAGCTGG + Intronic
1049486445 8:142866182-142866204 GAGCTATGGGGTGGCTTTGCTGG + Intronic
1051922806 9:22287606-22287628 GCCCCATGGAGTTGGTTTGCAGG - Intergenic
1055640246 9:78314030-78314052 ACCCTATCCTGTGTGTTTGCAGG + Intronic
1056846129 9:90039718-90039740 GCCTCATGGTGTGGGTGTGAAGG - Intergenic
1061855713 9:133440932-133440954 GTCCTACTGTGTGGGTTTGTGGG + Intronic
1185643406 X:1600552-1600574 GCCCCATGGTCTGGGGATGCAGG - Intronic
1187839835 X:23476149-23476171 CCCCTCTGGTGCGGGTCTGCTGG + Intergenic
1190152092 X:47957291-47957313 GGCCTGTGGTGTTGATTTGCTGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1194596647 X:95867600-95867622 GCCCTATGGTGTGGGTTCGCAGG - Intergenic
1195816350 X:108893710-108893732 GCCCAATGGTGCGGGTCTGGGGG - Intergenic
1196102140 X:111857611-111857633 GCCACATAGTGTGGCTTTGCAGG + Intronic
1199769229 X:150963554-150963576 ACTCTATGGAGTGGCTTTGCTGG + Intergenic