ID: 1062821202

View in Genome Browser
Species Human (GRCh38)
Location 10:535805-535827
Sequence TCCAGGAAATACGACACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062821198_1062821202 13 Left 1062821198 10:535769-535791 CCTATAGGTTTGGTTCAAAGAAT 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1062821202 10:535805-535827 TCCAGGAAATACGACACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062821202 Original CRISPR TCCAGGAAATACGACACCTT GGG Intronic
No off target data available for this crispr