ID: 1062823004 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:548601-548623 |
| Sequence | CAAGGGTTATGGGGGTGACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062822999_1062823004 | -8 | Left | 1062822999 | 10:548586-548608 | CCAGAGGTGACGTGGCAAGGGTT | 0: 1 1: 0 2: 1 3: 9 4: 63 |
||
| Right | 1062823004 | 10:548601-548623 | CAAGGGTTATGGGGGTGACATGG | No data | ||||
| 1062822994_1062823004 | 12 | Left | 1062822994 | 10:548566-548588 | CCGGGAGGGAGGTGATGTGGCCA | 0: 1 1: 0 2: 8 3: 160 4: 4146 |
||
| Right | 1062823004 | 10:548601-548623 | CAAGGGTTATGGGGGTGACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062823004 | Original CRISPR | CAAGGGTTATGGGGGTGACA TGG | Intronic | ||
| No off target data available for this crispr | |||||