ID: 1062823004

View in Genome Browser
Species Human (GRCh38)
Location 10:548601-548623
Sequence CAAGGGTTATGGGGGTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062822999_1062823004 -8 Left 1062822999 10:548586-548608 CCAGAGGTGACGTGGCAAGGGTT 0: 1
1: 0
2: 1
3: 9
4: 63
Right 1062823004 10:548601-548623 CAAGGGTTATGGGGGTGACATGG No data
1062822994_1062823004 12 Left 1062822994 10:548566-548588 CCGGGAGGGAGGTGATGTGGCCA 0: 1
1: 0
2: 8
3: 160
4: 4146
Right 1062823004 10:548601-548623 CAAGGGTTATGGGGGTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062823004 Original CRISPR CAAGGGTTATGGGGGTGACA TGG Intronic
No off target data available for this crispr