ID: 1062824572

View in Genome Browser
Species Human (GRCh38)
Location 10:558302-558324
Sequence CAGGGTCAGGAAGCGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 614}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062824572_1062824580 -8 Left 1062824572 10:558302-558324 CCACCTCCCGCTTCCTGACCCTG 0: 1
1: 0
2: 3
3: 60
4: 614
Right 1062824580 10:558317-558339 TGACCCTGAACCAGGATGGGAGG No data
1062824572_1062824584 24 Left 1062824572 10:558302-558324 CCACCTCCCGCTTCCTGACCCTG 0: 1
1: 0
2: 3
3: 60
4: 614
Right 1062824584 10:558349-558371 ATGTGTGTGAATAATTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062824572 Original CRISPR CAGGGTCAGGAAGCGGGAGG TGG (reversed) Intronic
900117076 1:1033486-1033508 CCGGGGCAGGTCGCGGGAGGAGG - Intronic
900250243 1:1665092-1665114 CAGGGTGTGGAAGAGGTAGGGGG + Exonic
900479409 1:2890865-2890887 CAGGGCCTGGAAGAGGCAGGAGG - Intergenic
900940405 1:5795039-5795061 CAGGGTGAGGGAGGGAGAGGAGG + Intergenic
901291151 1:8125574-8125596 CAGGGCCAGGCAGGGTGAGGAGG - Intergenic
901573412 1:10180376-10180398 TAGGGTCAGGAAGGGGGAGAGGG - Exonic
901650583 1:10740590-10740612 AAGGGTCTAGAAGCAGGAGGTGG + Intronic
902359767 1:15935996-15936018 CAGGGGCAGGAAGGGGGACAGGG - Exonic
902702411 1:18181545-18181567 CAGGAGCAGGAAGGGGAAGGAGG - Intronic
903225848 1:21893963-21893985 CAGGATGAGGCAGAGGGAGGAGG + Intronic
903466296 1:23554671-23554693 ACGGGGCAGGAAGCGGGTGGGGG + Intergenic
904044885 1:27603177-27603199 CAGCGCCGGGAAGGGGGAGGGGG - Intronic
904048676 1:27625041-27625063 CAGGGTCAGGAAACAGGGTGGGG - Intronic
904229180 1:29053163-29053185 CAGGGTCAGGTTGCAGAAGGTGG + Exonic
904590833 1:31614557-31614579 CAGGATCGGGAAGGAGGAGGAGG + Intergenic
905008852 1:34733105-34733127 CTGGCTCAGGAAGAAGGAGGAGG + Intronic
905037976 1:34929750-34929772 GAGGGAGAGGAAGAGGGAGGGGG + Intergenic
905658442 1:39701504-39701526 CAGGGCCAGGATGAAGGAGGGGG - Intronic
906292908 1:44631706-44631728 CAGGCACAGGAGGCGGGAGCCGG + Intronic
906304261 1:44706465-44706487 CAGGTTCAGGAAGCCCGGGGAGG + Intronic
906762094 1:48384344-48384366 CAGGGACAGGGAGAGGGAGAGGG + Intronic
907297266 1:53463273-53463295 CAGGGACAGGAACAGGAAGGAGG - Intronic
907299540 1:53477912-53477934 CTGGCTCAGGCAGCTGGAGGTGG - Intergenic
907499873 1:54871264-54871286 CAGGGTCAGGATACGGGAACCGG + Intronic
908021495 1:59902870-59902892 CAGAGTCAGAGAGTGGGAGGAGG + Intronic
909326561 1:74358291-74358313 CAGTGACAGGAAGCTGGAGGTGG + Intronic
909723584 1:78807063-78807085 AAGGGTGAGGAGGCAGGAGGGGG + Intergenic
910559486 1:88575344-88575366 CAGAGTGAGGAAGCAGGAGTGGG - Intergenic
912491467 1:110065000-110065022 AAGGGAAAGGAAGGGGGAGGCGG - Intronic
912784915 1:112592499-112592521 CAAGTTCAGGAAGCGTTAGGTGG - Intronic
913034046 1:114943760-114943782 CAGGGACAGGAATTGGGAAGAGG - Intronic
913098431 1:115541187-115541209 TAAGATCAGGAAGCGGGAGTGGG + Intergenic
914848026 1:151293471-151293493 TAGGGGCAGGAATGGGGAGGAGG + Intronic
915283314 1:154837500-154837522 CAGGGTGAGGAACCAGGAGGAGG - Intronic
915513984 1:156402163-156402185 CTGGGGCAGGAAGGAGGAGGTGG - Intergenic
915763030 1:158334741-158334763 CAGGGGCAGGAAGCAGGTGGTGG + Intergenic
915795608 1:158730769-158730791 TTGGGGCAGTAAGCGGGAGGTGG + Intergenic
915909913 1:159908559-159908581 AAGGGTCAGGGAGCCCGAGGTGG - Intergenic
915964498 1:160294524-160294546 AAGGGACAGGAAGAAGGAGGTGG - Exonic
916598671 1:166271464-166271486 CAGGGGCTGGAAGCTGGAGGTGG - Intergenic
918255529 1:182742765-182742787 CAGGGACAGGGAGAGGGAGAGGG + Intergenic
918355409 1:183703137-183703159 CAGGGCCTGGAAGCCGGCGGGGG - Intronic
919465395 1:197918231-197918253 CAGGGAGAGGAACTGGGAGGAGG + Intronic
920159838 1:203988106-203988128 CAGGGTGAGGACGTGGGAGGAGG + Intergenic
920232348 1:204479104-204479126 CAGGGTCAGGAACCAGAAGCTGG + Intronic
920291421 1:204925892-204925914 CAGGGTGAGGAAGCTGGGGTTGG + Intronic
920351223 1:205339291-205339313 CAGGGTCACAAAGCTGGAGAAGG + Exonic
920435090 1:205942333-205942355 CAGGGCCAGGATGAGGGAGGTGG + Intronic
921031852 1:211341025-211341047 GATGGTCAGGAAGGGGGAAGGGG + Intronic
921161052 1:212472403-212472425 CAGGGTGTGGAAACGGGAGCAGG - Intergenic
921498024 1:215864676-215864698 CAGTGTATGGAAGCTGGAGGAGG + Intronic
922041379 1:221901880-221901902 TGGGGTGAGGAAGGGGGAGGCGG - Intergenic
922222740 1:223620876-223620898 AAAGGTCAGGAAGCTGGAGATGG - Intronic
922754684 1:228089137-228089159 AAGGGGCAGGAATTGGGAGGAGG + Intronic
922794805 1:228334750-228334772 CGGGGCCAGGAGGCGGGCGGTGG + Intronic
922822609 1:228494471-228494493 GGGGGCCAGGAAGGGGGAGGTGG - Exonic
922930570 1:229386008-229386030 GTGGGTCAGGAGGCAGGAGGAGG + Intergenic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1062887826 10:1032491-1032513 GAGGGACAGGCAGGGGGAGGGGG - Intergenic
1062922330 10:1289628-1289650 CAGTGAGAGGAAGCAGGAGGTGG - Intronic
1062934352 10:1374938-1374960 GAGGGTCTGGAAGCGACAGGAGG + Intronic
1063240867 10:4168016-4168038 GAAGGACAGGAAGCGGGAGAAGG + Intergenic
1063368282 10:5504658-5504680 CAGGGTGAGGACTCGGAAGGTGG + Intergenic
1063964852 10:11338923-11338945 CAGGGTGAGGATGGGGGTGGGGG - Intergenic
1064172161 10:13043211-13043233 CTGGGTCAGGGAGAGGGAGAGGG - Intronic
1067082115 10:43217776-43217798 CTGGGTCAGGGAGTAGGAGGTGG - Intronic
1067582500 10:47454383-47454405 CAGGGGCATGTAGCAGGAGGCGG + Intergenic
1067836393 10:49644241-49644263 CAGGATCAGGGAGGGGCAGGAGG + Intronic
1068169590 10:53376067-53376089 CAGGGTTGGGAGGCCGGAGGAGG + Intergenic
1068794273 10:61061045-61061067 AAGGGTGAGGAGGTGGGAGGGGG - Intergenic
1068969411 10:62946982-62947004 CAGGGACAGGGAGAGGGAGAGGG - Intergenic
1069512572 10:69053234-69053256 CAGGGCCAGGAAGGGTGTGGTGG + Intergenic
1069602386 10:69716443-69716465 CCGGGTGAGGAGGCGTGAGGTGG + Intergenic
1069755901 10:70774391-70774413 CAGGGACAGGAAGGGGGCTGGGG - Intronic
1069827039 10:71260738-71260760 CAGGGCCAGAAGACGGGAGGAGG + Intronic
1070170512 10:73929375-73929397 AAGGGTCAGGAAACAGGAGAAGG + Intergenic
1070600920 10:77865720-77865742 CAGGCGCAGGAAGCGGGGGAGGG + Intronic
1071450754 10:85789993-85790015 CAGAGTCAGGAAAAGGGAGAGGG - Intronic
1071517912 10:86311306-86311328 CAGCTTCAGCAAGCAGGAGGAGG + Intronic
1071564920 10:86666855-86666877 CAGGGCCAGGGAGCTGGGGGAGG - Intergenic
1071873211 10:89817319-89817341 TAGGGGCAGGGAGCAGGAGGTGG - Intergenic
1072755833 10:98020147-98020169 CAGCGTGTGGAAGTGGGAGGAGG - Intronic
1072881897 10:99236235-99236257 TAGGGTCAGGAAGCAGAGGGAGG + Intergenic
1073288785 10:102403209-102403231 CAGGGGCAGGCAGTGGGCGGCGG - Exonic
1073351478 10:102822980-102823002 CAGGGTCAGGAAACGGGAGCTGG + Intergenic
1074202286 10:111248641-111248663 GGGGGTCAGGAAGGGGCAGGAGG - Intergenic
1075082899 10:119395840-119395862 TAGGGTCATGCAGCGGGAGGTGG - Intronic
1075512942 10:123086897-123086919 CAGGGTCACGGAGGTGGAGGTGG + Intergenic
1076035581 10:127196425-127196447 CAGGGCCAGGAGGCGGGGGCGGG + Intronic
1076335004 10:129701008-129701030 CAGGTTCTGGAAGCCAGAGGAGG + Intronic
1077119701 11:901184-901206 CAGGGTCAGGAAGGGGGCCTTGG - Intronic
1077229821 11:1453749-1453771 CAGAGGCAGGGACCGGGAGGAGG - Intronic
1077370762 11:2180565-2180587 CAGGAGCAGGAAGGAGGAGGTGG + Intergenic
1077404226 11:2375717-2375739 CACTCTCAGGAAGTGGGAGGAGG - Intergenic
1077459653 11:2702632-2702654 CAGGGTTAGGTAGAGGGTGGAGG - Intronic
1078359625 11:10658237-10658259 CAAGGTTAGGAAGCAGGATGGGG - Intronic
1078452326 11:11449486-11449508 CAGTGTCTGGAAGCAGCAGGAGG - Intronic
1081782626 11:45723669-45723691 TAGAGTCAGGAGGTGGGAGGAGG - Intergenic
1081794568 11:45810727-45810749 AAGGGTGAGGAAGAGGGATGAGG - Intronic
1083561918 11:63679880-63679902 CAGCCTCATGAAGCGGGAGGTGG - Intergenic
1083635002 11:64116179-64116201 CAGGGGCAGTGAGAGGGAGGCGG - Intronic
1083694866 11:64436138-64436160 CTGGGCCAGGAAGCGGGCAGCGG + Intergenic
1083767050 11:64846543-64846565 CAGGATCAGGTTGAGGGAGGAGG + Intergenic
1083902501 11:65650446-65650468 CATGCTCAGGAAGCTGCAGGAGG + Exonic
1084122371 11:67077280-67077302 CAGGGTGAGGAGGATGGAGGAGG - Intergenic
1084151251 11:67289015-67289037 CCGGGTCCGGAAGAGGAAGGCGG - Intronic
1084483002 11:69432814-69432836 TAGGGTCAGGAAGGGGGCTGTGG + Intergenic
1084793508 11:71489748-71489770 GAGGGTCAGGAAGGGTGAGAAGG + Intronic
1084978945 11:72818384-72818406 AAGGGACAGGAATAGGGAGGAGG - Intronic
1085360310 11:75878887-75878909 CAGGGACAGGGACAGGGAGGGGG + Intronic
1085360314 11:75878893-75878915 CAGGGACAGGGAGGGGGAGGGGG + Intronic
1085698000 11:78722000-78722022 CAGGGTCAGGATGGGGAAAGAGG + Intronic
1087149930 11:94850235-94850257 CAGGGTCATCAAGCTGGAAGAGG + Exonic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1089093328 11:115897012-115897034 CATGGTTTGGAAGTGGGAGGGGG - Intergenic
1089119929 11:116126631-116126653 GAGGGCCAGGCAGCGGGTGGTGG - Intergenic
1089150021 11:116357290-116357312 CAGGGTCAGGAAGAAGCCGGGGG - Intergenic
1089398673 11:118152283-118152305 GAGGTTCAGGATGCTGGAGGAGG - Intronic
1089673245 11:120071845-120071867 AAGGGTCTGGAATCGGGATGAGG + Intergenic
1089839265 11:121400164-121400186 CAGGGGCAAGAGGTGGGAGGGGG + Intergenic
1090190075 11:124761567-124761589 CCAGGGCAGGAAGCAGGAGGGGG + Intronic
1090803555 11:130189009-130189031 GTGGGGCAGGAAGCGGGAGATGG + Intronic
1091015855 11:132050241-132050263 CAGGGTCAAGCAGCTGGAGAGGG + Intronic
1091037610 11:132247639-132247661 CAGGGTCTTCAAGCAGGAGGTGG + Intronic
1091302157 11:134514691-134514713 TAGGGTCAGGAGGCGGGAGTGGG - Intergenic
1091303872 11:134524287-134524309 CAGGGTCCTGAGGCGGGAGCCGG - Intergenic
1091688473 12:2580080-2580102 CAGAGTTGGGAAGCTGGAGGGGG + Intronic
1092002441 12:5043798-5043820 CCGGGAGGGGAAGCGGGAGGAGG + Intergenic
1092112787 12:5975865-5975887 AGGGGTGAGGAAGAGGGAGGGGG - Intronic
1092194404 12:6540651-6540673 GAGGGTGAGGCAGCAGGAGGAGG - Intronic
1092262743 12:6961222-6961244 CAGGGTCAGGGAGAGGTGGGGGG - Exonic
1092778157 12:11961985-11962007 GAGGGCCAGGAAGCAGGAGGTGG + Intergenic
1092805304 12:12216837-12216859 CAGGGGCAGGGGGAGGGAGGGGG - Intronic
1093053630 12:14532856-14532878 CAGTCTCAGGATGCTGGAGGGGG + Intronic
1093523347 12:20076116-20076138 GAGGGTGAGGAAGAGGGAGAGGG - Intergenic
1095279114 12:40328877-40328899 CAAGGTCTGGAAGCAGGTGGAGG - Intronic
1095668401 12:44830625-44830647 CAGGCTCAGAAACCGGGAGATGG - Intronic
1096525383 12:52207179-52207201 TAGGGCCAGGAAGCTGGAAGGGG + Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096599428 12:52718826-52718848 GAGGGCCAGGAAGAGGGAGGAGG - Intergenic
1097035544 12:56121297-56121319 CATGCTCAGGAAGCGGGTAGAGG + Exonic
1097191260 12:57220661-57220683 CAGGATCAGGCTGTGGGAGGGGG - Intronic
1098134147 12:67383801-67383823 CAGGGTCATGGAGCTGGTGGGGG + Intergenic
1099578258 12:84406849-84406871 CAGGTTCAGGAATCAGGGGGTGG + Intergenic
1099927647 12:89037758-89037780 CAGGGTGAAGAGGTGGGAGGCGG - Intergenic
1100142229 12:91633231-91633253 CAGACTCAGGAAGCCTGAGGAGG + Intergenic
1100401191 12:94231601-94231623 CAGGGTCAGGATACAGGAGTAGG - Intronic
1100891062 12:99126497-99126519 CAGGGTAAGGTGGGGGGAGGGGG - Intronic
1101016678 12:100508233-100508255 CAGGCTCAGGAAGCAGCAGGTGG + Intronic
1101642781 12:106600740-106600762 CAGCATGACGAAGCGGGAGGTGG - Intronic
1102383163 12:112484493-112484515 CAGGGGCAGGAGGAGGCAGGTGG + Intronic
1103873637 12:124110026-124110048 CAGGGACATGAGGCTGGAGGTGG + Intronic
1103899248 12:124295033-124295055 CGGGGAGAGGAAGGGGGAGGAGG + Intronic
1104031057 12:125065897-125065919 CAGAGTCAGGAAGTGCCAGGAGG - Intronic
1104410175 12:128551214-128551236 CCAGGGGAGGAAGCGGGAGGGGG - Intronic
1104461709 12:128961966-128961988 AAGTGTCAGGAAGGGAGAGGGGG - Intronic
1104487443 12:129163664-129163686 GAGGGGCAGGGAGCGGGAGTTGG - Intronic
1104985293 12:132593232-132593254 GCGGGTCCGGAGGCGGGAGGAGG - Intergenic
1106137798 13:26987304-26987326 AAGGGGTTGGAAGCGGGAGGTGG - Intergenic
1107999292 13:45891615-45891637 CAAGGTTAGGGAGCAGGAGGTGG + Intergenic
1108386162 13:49901374-49901396 CAGGGCCAGGATGCGAGTGGGGG + Intergenic
1109300772 13:60587626-60587648 CAGGGGCAGGAACCGGGATGAGG - Intergenic
1111560078 13:89932885-89932907 CAGGGACAGGGAGAGGGAGAGGG + Intergenic
1111905516 13:94251289-94251311 CAGGGCCAGGCAGGGGGTGGGGG + Intronic
1112503209 13:99957644-99957666 CCGGGTCAGGACGCGGGCAGAGG - Intergenic
1113400270 13:109985983-109986005 CAGGGTCAGGCAGTGGGAGGAGG - Intergenic
1113414466 13:110117565-110117587 GAGGTTCAGAAGGCGGGAGGCGG + Intergenic
1113542295 13:111118251-111118273 CAGAGTTAGGAAGAGGGTGGAGG + Intronic
1113692788 13:112323632-112323654 CAGGGGCAGGAAGCGGAGGGAGG - Intergenic
1113783160 13:112988041-112988063 CAGGGTCAGGCTGCGGGGCGAGG + Intronic
1114550856 14:23532130-23532152 CAGGAGCAGGAAGCGAGGGGTGG - Intronic
1114558159 14:23573712-23573734 GAGGATCAGGCAGTGGGAGGAGG - Intronic
1114866800 14:26605521-26605543 CAGTGTCAGGAAGATAGAGGGGG + Intergenic
1116430037 14:44835952-44835974 CAAGGTGAGGTAGGGGGAGGGGG - Intergenic
1118004625 14:61554293-61554315 AAGAGCCAGGAAGCAGGAGGAGG - Intronic
1119176171 14:72568957-72568979 CTGGGTTAGGAAGGGGTAGGAGG + Intergenic
1119264237 14:73254712-73254734 CAGGGTCAGGCAGCAGGTGTGGG - Intronic
1119472039 14:74906390-74906412 CATGGTCAGGAATCGGGGGTGGG + Exonic
1119722200 14:76898879-76898901 CAGGGACAGGGAGAGGGAGAGGG + Intergenic
1120738293 14:88079480-88079502 CAGTGTCAGGAAGCTGGCAGAGG - Intergenic
1121123614 14:91392177-91392199 CAGGTTCAGGAAGGGAGAGCTGG - Intronic
1121582445 14:95040953-95040975 CAGTGTTTGGAAGGGGGAGGGGG + Intergenic
1121708221 14:96017174-96017196 CAAGGTGAGGATGCTGGAGGAGG - Intergenic
1121798382 14:96754116-96754138 CAGGGTGTGGAAGGGGGAGAGGG + Intergenic
1121826198 14:97011525-97011547 CAGGGACAGGAAGAGAGATGCGG - Intergenic
1122830902 14:104395224-104395246 CAGGGTCAGGGAGAGGGTAGGGG + Intergenic
1123030735 14:105449919-105449941 CAGTGTCCGGCAGCAGGAGGAGG + Intronic
1123907554 15:24935548-24935570 CAAGGTAAGGAAGAGAGAGGAGG + Intronic
1124022020 15:25933793-25933815 CAGAGTCTGAGAGCGGGAGGGGG - Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124971548 15:34494679-34494701 CACGGTGAGGAAGCGGCAGTCGG - Intergenic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125429479 15:39580982-39581004 GCCGGGCAGGAAGCGGGAGGTGG - Intergenic
1125616409 15:41017754-41017776 CAGCTTCAGGGAGCGGGTGGTGG - Intronic
1125724754 15:41862579-41862601 CAGGCACAGGCAGCAGGAGGTGG - Exonic
1126355194 15:47787986-47788008 CAGGGAAGAGAAGCGGGAGGAGG + Intergenic
1127606554 15:60592626-60592648 CCGGGGCGGGAGGCGGGAGGCGG + Intronic
1128226733 15:66006946-66006968 CTGGGTGAGGGAGAGGGAGGGGG - Intronic
1128347343 15:66862852-66862874 CATGGTCCAGAAGAGGGAGGGGG - Intergenic
1128452244 15:67812268-67812290 TGGGGTCAGGAATAGGGAGGAGG + Intergenic
1128468307 15:67930919-67930941 CAGACTAAGGAAGCTGGAGGGGG + Intergenic
1128576864 15:68782207-68782229 CAGTGCCAGGAACCTGGAGGAGG + Intronic
1128997401 15:72306989-72307011 AAGGGTAAGGAAGCGGGTGCAGG + Intronic
1129106702 15:73314430-73314452 CAGGGTTCGGGAGTGGGAGGAGG + Intergenic
1129153193 15:73702177-73702199 CAGGGGCAGGGAGCGGGACTAGG + Intronic
1129184812 15:73899576-73899598 AAGGGTCTGGAGGTGGGAGGTGG + Intergenic
1129318235 15:74759156-74759178 GAGGCTCAGGAAGCATGAGGAGG + Intergenic
1129377074 15:75140483-75140505 CAGGGACAGAGAGCCGGAGGTGG + Intergenic
1129667978 15:77590147-77590169 CAGGGGCAGGAGGGGTGAGGGGG + Intergenic
1129718829 15:77866734-77866756 CAGAGTCAGGGAGATGGAGGTGG - Intergenic
1129790547 15:78338152-78338174 CTGGGGCAGGAGGCTGGAGGAGG - Intergenic
1130460101 15:84154126-84154148 CAGAGTCAGGGAGATGGAGGTGG + Intergenic
1130657063 15:85799131-85799153 CAGGGTCAGGAACAGGGAGGTGG - Intergenic
1131181650 15:90244114-90244136 CAAGGTCAGGCAGCTGGAGTCGG + Exonic
1131382385 15:91974602-91974624 CAGGGCAGGGAGGCGGGAGGTGG + Intronic
1131974476 15:97930489-97930511 CAGGTTCAGGTAGCAGGAGCAGG + Intergenic
1132111040 15:99102678-99102700 CAGGGCCGGGAGGTGGGAGGGGG - Intronic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132603004 16:782235-782257 CAGGAGCAGGGAGCGGGAGCCGG + Intronic
1132713667 16:1280072-1280094 CAGGGCCTGGAGGCGGGAGGAGG + Intergenic
1132876971 16:2144289-2144311 CAGAGTCTGGAAGCCTGAGGAGG + Intronic
1133234248 16:4380472-4380494 CAGGGTCTGGAAGAGGGGGCAGG - Intronic
1135802339 16:25509629-25509651 CAGGGTGGGGAAGTTGGAGGTGG - Intergenic
1135984548 16:27174456-27174478 CAGGGTCTGGAATCTGGGGGAGG - Intergenic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1137013208 16:35344633-35344655 CAGGGGCAGGGCACGGGAGGAGG - Intergenic
1137369003 16:47887347-47887369 CAGGGTCAGGGAGGGGGCTGCGG - Intergenic
1137484440 16:48880109-48880131 CAGAGTGAGGAAGAAGGAGGCGG - Intergenic
1137512490 16:49113948-49113970 AAGGGTCAGGAATCTGGAAGTGG + Intergenic
1137590363 16:49689738-49689760 CAAGGTCAGGAACAGGCAGGTGG + Intronic
1137702350 16:50506331-50506353 CAGGGGCAGGGAGCAGGAAGTGG + Intergenic
1138243248 16:55446046-55446068 CCGGGTCAGGATGCGGAAGGCGG + Intronic
1138554737 16:57764788-57764810 CAGGGTCATGAAGATGGATGGGG + Intronic
1140055751 16:71524105-71524127 CAGGGTAAGGTAGCAGGAGTAGG + Intronic
1140265742 16:73418933-73418955 CAGGATCTGGAATTGGGAGGTGG - Intergenic
1141165439 16:81657588-81657610 CAAGGTCGGGAAGGGGGAGAAGG - Intronic
1141415010 16:83863860-83863882 CAGGGCCAGGAAGATGGAGTAGG + Intergenic
1141821344 16:86448118-86448140 CACGCTCAGGAGGCGGGAGAAGG + Intergenic
1142256983 16:89018774-89018796 CAGCCTCCGGAAGCAGGAGGTGG + Intergenic
1142355773 16:89601122-89601144 CAGGGTCACACAGCGGGAGCTGG - Intergenic
1142788314 17:2243044-2243066 CAGTGGCAGGACGGGGGAGGTGG + Intronic
1142900654 17:3009527-3009549 CAAAGTCAGGAAGTGGGAGGTGG - Intronic
1142905337 17:3037369-3037391 AAGGAGCAGGAAGCGGGGGGGGG - Exonic
1143028659 17:3955201-3955223 CAGTGTCAGGAAGAAGGAGGTGG - Intronic
1145278790 17:21453738-21453760 CACTGTCAGGAAGCAGGAGGAGG - Intergenic
1145399064 17:22516748-22516770 CACTGTTAGGAAGCAGGAGGAGG + Intergenic
1145779774 17:27554742-27554764 CAGGGACAGGGAGCGGGGGATGG - Intronic
1145836366 17:27957000-27957022 CAGTGTCAGGAAGGGGGTTGGGG + Intergenic
1145903696 17:28505154-28505176 AAGGGTCAGGGAGATGGAGGAGG + Intronic
1145909482 17:28534276-28534298 CAGGCTCAGGAAGCCAGAGCGGG - Intronic
1145921710 17:28614662-28614684 CTGTGCCAGGAAACGGGAGGGGG - Exonic
1146027143 17:29331380-29331402 AAGGATGAGGAAGCAGGAGGGGG - Intergenic
1146920080 17:36704297-36704319 CAGGGTCAGGAAGGGGGTCAAGG + Intergenic
1147020706 17:37530344-37530366 CAAGGTCAGGAAGCAGCAGGTGG + Intronic
1147459667 17:40560237-40560259 GAGGGTCAGGATACGGGAAGAGG - Intronic
1147599787 17:41738677-41738699 CAGGGTCAGGCCAGGGGAGGGGG - Intergenic
1147723888 17:42554718-42554740 CAGGGGCAGGAAGCGCTCGGTGG - Exonic
1147904340 17:43813154-43813176 CAAGGGCACGAAGTGGGAGGCGG + Intronic
1148468715 17:47880237-47880259 CAGGGTGGGCAAGTGGGAGGAGG - Intergenic
1148561277 17:48608046-48608068 CAGGGTCTGGTAGCGGGTGTAGG + Exonic
1149523547 17:57336855-57336877 GAGGGTCAGGAATCTGGAGTGGG + Intronic
1149572609 17:57684095-57684117 CAGGGGCATGATGGGGGAGGGGG + Exonic
1149632843 17:58141787-58141809 GAGGGAGAGGAAGAGGGAGGGGG - Intergenic
1151430036 17:74056169-74056191 CAGGATCAGGAAGCGGGTGATGG - Intergenic
1151715998 17:75831336-75831358 CAGGGTCAGGAGGCTGGGGCGGG + Exonic
1151732073 17:75917596-75917618 TAGAGGCAGGAAGCGGCAGGTGG + Intronic
1151816616 17:76474334-76474356 CAGGGTCTGGCAGGGGTAGGAGG + Intronic
1151823335 17:76509109-76509131 GAGGATTAGGAAGGGGGAGGTGG + Intergenic
1151994804 17:77601779-77601801 CAGGGGCAGGATGGGGGCGGAGG + Intergenic
1152068563 17:78124364-78124386 CAGGGTCATTGAGGGGGAGGCGG + Intronic
1152146591 17:78572320-78572342 CAGGGTCAGTGAGTGGGAGTGGG - Intronic
1152210095 17:78998561-78998583 CAGGGTCAGGGTGCTGGTGGCGG + Intronic
1152336017 17:79700574-79700596 CAGGGTGGGGGAGCTGGAGGGGG + Intergenic
1152561547 17:81081307-81081329 CAGGATCAGGAAGCCTGAGACGG - Intronic
1152633424 17:81420777-81420799 AAGGGACAGTAAGCGGGATGCGG - Intronic
1152734929 17:81992624-81992646 CAGGGCCAGGAAGGGGGACAGGG - Intronic
1152763890 17:82125024-82125046 GAGGGTCAGGAAGACGGAGTGGG + Intronic
1153565461 18:6414240-6414262 CAAGGGCAGAAAGCGGGTGGAGG + Intronic
1155068223 18:22287317-22287339 CAGGGGCAGGGAGAGGAAGGTGG - Intergenic
1155359103 18:24982401-24982423 GAGGGTCAGGGAGCAGGAAGGGG - Intergenic
1156047083 18:32889022-32889044 CAGGGTGAGGAGGTGAGAGGTGG + Intergenic
1157522142 18:48352596-48352618 CAGGGTGAGCAGGCTGGAGGAGG + Intronic
1157857888 18:51118080-51118102 CAGGGACAGGGAGAGGGAGAGGG + Intergenic
1158953825 18:62522444-62522466 CTGGGTCCGGACGCGGGTGGCGG - Intergenic
1159505355 18:69328443-69328465 CAGGGGCAGGGTGCTGGAGGAGG - Intergenic
1159917359 18:74198943-74198965 CCGGGTGAGGGAGCTGGAGGTGG + Intergenic
1159917373 18:74198986-74199008 CTGGGTAAGGGAGCTGGAGGTGG + Intergenic
1160899247 19:1419026-1419048 GAGGGCCAGGCAGTGGGAGGGGG - Intronic
1160957156 19:1699063-1699085 CAGGGGCATAAAGCGGGAGCGGG + Intergenic
1160965728 19:1746176-1746198 GAGGGGCAGGAAGGGGGAGGAGG + Intergenic
1161070130 19:2255836-2255858 CAGGGTCACGCAGCAGGATGTGG - Intronic
1161117131 19:2503949-2503971 CAGGGCCCGTAGGCGGGAGGAGG - Intergenic
1161122573 19:2537634-2537656 ATGGGACAGGAAGCTGGAGGCGG + Intronic
1161214946 19:3089712-3089734 AAGGGCCAGGTAGAGGGAGGAGG + Intergenic
1161363370 19:3864033-3864055 GAGTTTCAGGAAGTGGGAGGCGG - Intronic
1161411811 19:4121894-4121916 AAGGGTCAGGATGTGGGAGAGGG - Intronic
1161978172 19:7617517-7617539 GAGGGTGAGGCAGTGGGAGGGGG - Intronic
1162410006 19:10499977-10499999 CAGGGGCAGGAATCGGCAGCAGG + Exonic
1163065069 19:14786494-14786516 CAGCGGCGGGAAGCCGGAGGTGG + Intergenic
1163099474 19:15085689-15085711 CAGGGGCTGGGGGCGGGAGGTGG - Intergenic
1163688506 19:18725659-18725681 GAGGCTCAGGAAGAGGGAGGAGG - Intronic
1163728951 19:18938938-18938960 CAGGGCCAGGCTGGGGGAGGTGG + Intronic
1163839485 19:19597482-19597504 CAGGGTCATGCAGCCAGAGGTGG + Intronic
1164220649 19:23190546-23190568 CTGGGTCAGGTAGCATGAGGTGG + Intergenic
1164451614 19:28370898-28370920 CAGGGACCAGGAGCGGGAGGCGG + Intergenic
1164467314 19:28498695-28498717 CAGGGTCAGGATAGGGGAGCAGG + Intergenic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1164715169 19:30385605-30385627 CAGGGTCTGGAAGAAGGAGAAGG - Intronic
1165433517 19:35784998-35785020 CAGCGTCAGCAGGCGGGTGGAGG - Exonic
1165846222 19:38819398-38819420 CGGGGTCAGGATGCGGGGGATGG - Intronic
1165852356 19:38856714-38856736 CAGGGACAGGGAGAGGGAGAGGG + Intergenic
1166007329 19:39916522-39916544 GAGGGTGAGGACCCGGGAGGAGG - Intronic
1166199317 19:41226282-41226304 CAGGGTCAGCGCGCGGGAGCTGG - Intronic
1166214640 19:41327457-41327479 CCGGGTCAGCAAGGGGGAGTGGG - Intronic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1166294681 19:41883199-41883221 CAGAGCCAGGAAGCGGGAGCCGG + Intronic
1166306945 19:41940515-41940537 CAGATTCAGGAAAGGGGAGGGGG + Intergenic
1166528835 19:43530269-43530291 CAGGGCCTGGAAGTGGGTGGAGG - Intronic
1166731887 19:45064044-45064066 CGGGGTCGGGGAGCGGGAGCGGG - Exonic
1166846232 19:45730484-45730506 CAGGGTTAGGATGAGTGAGGGGG - Intronic
1166851421 19:45763315-45763337 CTGGGACAGGAAGGAGGAGGAGG - Intronic
1166863805 19:45824271-45824293 CAGGCTCAGGAAGCAGCAGCAGG - Intronic
1167253480 19:48414084-48414106 CAGAGACAGGACGTGGGAGGTGG + Exonic
1167308946 19:48725296-48725318 GAGAGTCAGGAAGTGGGAGTGGG + Intronic
1167594463 19:50419762-50419784 CTGGGACAGGAAGTGGGGGGTGG - Intronic
1168063870 19:53908692-53908714 CGGCTGCAGGAAGCGGGAGGGGG - Intergenic
1168078457 19:53992844-53992866 TGGGGTCGGGAAGGGGGAGGAGG - Exonic
1168080012 19:54003188-54003210 CAGGCTCAGGGAGGGGGAGGCGG + Intronic
1168140234 19:54381029-54381051 CAGGGTCACGAAGGGGAAAGTGG - Intergenic
1168267607 19:55231077-55231099 CAGGGACAGGAGGCGGGAAGAGG - Intronic
1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG + Intronic
925346583 2:3176131-3176153 CAAGGTGGGGAAGCAGGAGGCGG + Intergenic
925429998 2:3783223-3783245 GAGGGACAGGAAGAGGGAGTGGG + Intronic
925436455 2:3842426-3842448 CAGGGTGAGGAAGGGGGTGGTGG + Intronic
925564464 2:5235355-5235377 CAGGGTCAGTAAGTGGTAGATGG + Intergenic
925776048 2:7337250-7337272 CAGGGGCAGGAAGCACTAGGTGG + Intergenic
926008727 2:9392203-9392225 TTGGGTAAAGAAGCGGGAGGAGG + Intronic
926245805 2:11121817-11121839 CAGGGTGATGAAGCAGGAGCGGG + Intergenic
926266821 2:11330824-11330846 GAGGGGGAGGAAGAGGGAGGAGG + Intronic
926266830 2:11330846-11330868 GAGGGGGAGGAAGAGGGAGGAGG + Intronic
926839921 2:17068727-17068749 CAGGGTTAGGAGGCGGGTGAAGG - Intergenic
927150718 2:20194249-20194271 CAGGGTCAGGAGGTGTGAGGAGG - Intergenic
927940516 2:27100364-27100386 CTGGGGCAGTCAGCGGGAGGAGG - Exonic
929269630 2:39959350-39959372 CAGGTCCAGGAATCGAGAGGCGG - Intergenic
929583302 2:43098206-43098228 CAGGGTCAGGAATCCGGACAGGG + Intergenic
929876576 2:45801511-45801533 GAGGGTGAGGGAGAGGGAGGAGG + Intronic
930113185 2:47696301-47696323 CAGGTTCTGGGAGGGGGAGGAGG + Intronic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
930730393 2:54723497-54723519 CAGGGACAGGCAGAGGGAGGGGG + Intronic
931790189 2:65658042-65658064 CAGGGTCAGGCAGGGGCTGGAGG + Intergenic
931827839 2:66019832-66019854 CAGCCACAGGAAGCTGGAGGAGG - Intergenic
932303558 2:70685815-70685837 CTGGGGGAGGAAGAGGGAGGTGG - Intronic
932534771 2:72581672-72581694 CAGGGGCAGGGTGCGGGAGGTGG - Intronic
932700133 2:73985989-73986011 CAGGGTCTGGACGCTGGAGAAGG - Intergenic
932780049 2:74554126-74554148 GAGGGCCAGGGAGGGGGAGGGGG - Exonic
934049197 2:88196185-88196207 CAGGGGCAGGAGCGGGGAGGAGG - Intergenic
936153763 2:110035520-110035542 CAGGCCCAGGGAGCAGGAGGTGG - Intergenic
936190922 2:110335895-110335917 CAGGCCCAGGGAGCAGGAGGTGG + Intergenic
936970785 2:118174765-118174787 CAGGGTTAAGAGGTGGGAGGAGG + Intergenic
937207613 2:120246532-120246554 CCGAGTTAGGAAGGGGGAGGAGG - Intronic
937883785 2:126886688-126886710 GCGGGTGAGGAAGCGGGTGGAGG - Intergenic
938008128 2:127805583-127805605 CAGAGTCAGGAAGGGGCAGCAGG + Intronic
938249899 2:129806512-129806534 CAGGGTGGGGAAGCTGAAGGAGG - Intergenic
940337711 2:152546369-152546391 CATGGTGAGCAAGAGGGAGGAGG + Intronic
940557868 2:155255320-155255342 AAGGGGCAGGGAGAGGGAGGTGG - Intergenic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
941792478 2:169567797-169567819 CAGGGTGAGGAAGAGATAGGAGG - Intronic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
943793681 2:191965232-191965254 CAGGGGAAGGAAGTGGGAGAAGG - Intronic
946021721 2:216644747-216644769 CTGGGGCAGGAAGTGGGAGAGGG - Intronic
946187842 2:217991174-217991196 CAGGGTCCAGAGGAGGGAGGAGG + Intronic
946653363 2:221917906-221917928 AAGGGACAGGAAGCAGGGGGTGG - Intergenic
946820036 2:223619917-223619939 CAGGGACTGGCAGCGGGAGGGGG - Intergenic
947152285 2:227128192-227128214 CAGGCTCAGGTAGGGGGAAGAGG - Intronic
948085076 2:235240725-235240747 CAGGGGCAGGAACCCAGAGGAGG - Intergenic
948568362 2:238900763-238900785 CTGGGTCTGGAAGCCGTAGGAGG + Intronic
948809709 2:240468340-240468362 CAGGGGCAGGAGGCAGGAAGAGG - Intergenic
1168739556 20:176180-176202 CAGGGTGAGGAACAGGGAAGAGG - Intergenic
1168805976 20:672621-672643 CAGGGTCAGGATGAGGCTGGCGG - Intronic
1169278617 20:4249320-4249342 CAGCGCCAGGAAGGAGGAGGGGG + Intergenic
1170205117 20:13789831-13789853 CAGGGTGAGGAAGGGAGTGGTGG + Intronic
1171210101 20:23310368-23310390 CAGGGTGAGGAAGTGGGGGTGGG - Intergenic
1171972478 20:31573013-31573035 CCGGGCCAGGGCGCGGGAGGCGG + Intronic
1172056866 20:32160122-32160144 CAGGGCCAGGAGGCGGGGGAGGG + Intronic
1172109090 20:32535022-32535044 CAGGGAAAGGAAGGAGGAGGTGG + Intronic
1172442191 20:34973663-34973685 CAGCGACAGGAAGCAGGATGCGG - Intergenic
1172612310 20:36261178-36261200 CAGGGTCAGTAGGCAGGAGTGGG + Intronic
1173143173 20:40502614-40502636 CTGGGTGAGGAAGGAGGAGGGGG - Intergenic
1173243358 20:41317337-41317359 CAGGGGCAGCCGGCGGGAGGGGG + Intronic
1173551735 20:43937452-43937474 CAGTTTGAGGAAGGGGGAGGAGG + Intronic
1173837932 20:46138086-46138108 CAGGGGCAAGAAGCAGGAGTGGG - Intergenic
1173916562 20:46712417-46712439 CAGGGTCAGGGGGCAGGGGGAGG - Intronic
1174079865 20:47963018-47963040 CAGGCTCAGGGAGTAGGAGGGGG - Intergenic
1174404146 20:50292845-50292867 CGGGATCAGGAAGCTGCAGGGGG - Intergenic
1174843837 20:53924155-53924177 CGGGGTCAGTATGAGGGAGGCGG - Intergenic
1175345067 20:58267032-58267054 CAGGCTCAGGAAGGGGAGGGAGG + Intergenic
1176101981 20:63368531-63368553 CAGGGTCCTGAACCTGGAGGGGG - Intronic
1176148860 20:63578777-63578799 CAGCGTCACGAAGCAGGTGGAGG + Intergenic
1176189931 20:63803674-63803696 CAGGTTCGGGAAGGCGGAGGAGG - Intronic
1176214045 20:63939923-63939945 CTGGGTCAGGAGGCAGGAGGAGG + Exonic
1177257457 21:18683868-18683890 CAGGGTGTGGAAGAGGGAGGAGG + Intergenic
1177301891 21:19257382-19257404 GAGGGACAGGAGGCAGGAGGAGG + Intergenic
1178434739 21:32548071-32548093 AAGGATGAGGGAGCGGGAGGGGG - Intergenic
1179034922 21:37751410-37751432 CAGGGAGAGCAAACGGGAGGTGG + Intronic
1179450486 21:41465398-41465420 CAGGGTCAGGGAGGATGAGGAGG + Exonic
1179592480 21:42418297-42418319 GAGGGGCAGAAAGCAGGAGGTGG + Intronic
1179926955 21:44540016-44540038 CAGGGTCAGGCAGGGGGCCGGGG + Exonic
1179928460 21:44551324-44551346 CAGGGTCAGGCAGGGGGCTGGGG + Exonic
1179929622 21:44558581-44558603 CAGGGTCAGGCAGGGGGCCGGGG + Exonic
1179939184 21:44627284-44627306 CAGGGTCAGGCAGGGGGCCGGGG - Exonic
1179949588 21:44702308-44702330 CAGGGTCAGGCAGGGGGCCGGGG - Intronic
1180005474 21:45018733-45018755 CTGGGACAGGGAGCGGGTGGGGG + Intergenic
1180638803 22:17281642-17281664 CAGAGCTAAGAAGCGGGAGGTGG - Intergenic
1181012955 22:20052925-20052947 CAGAGACAGGAAGAGTGAGGAGG + Intronic
1181236591 22:21450887-21450909 CAAGGTGAGGTAGGGGGAGGGGG - Exonic
1181509772 22:23383926-23383948 CAGGGTCCGGGAGCAGGTGGGGG + Intergenic
1181802939 22:25359015-25359037 CAGGGTCACACAGCAGGAGGTGG - Intronic
1181859422 22:25806521-25806543 CTGGGGAAGGCAGCGGGAGGGGG + Intronic
1181934249 22:26428109-26428131 TAGGTTCTGGAAGAGGGAGGAGG + Intergenic
1182476321 22:30578584-30578606 CAGACTCAGGAAGCCGGATGCGG + Intronic
1182835497 22:33338238-33338260 CAGGGACAGGAAGCAACAGGAGG - Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183077390 22:35435681-35435703 GAGGGGCAGGCAGAGGGAGGGGG + Intergenic
1183149723 22:36028347-36028369 CCGGGGCATGAAGCGGGAGTCGG - Exonic
1183243307 22:36674253-36674275 CATGCTGAGGAAGTGGGAGGTGG - Intronic
1183525395 22:38319590-38319612 CTGGGTTAGGAAGGGGCAGGGGG - Intronic
1183952558 22:41359715-41359737 CAGGGTAAGGAAGAGAGAGTGGG + Exonic
1184474677 22:44714123-44714145 CAGGGGCAGGAAGCATGAGGGGG + Intronic
1184898412 22:47425963-47425985 CAGAGTCAGGTGGAGGGAGGTGG + Intergenic
1184916167 22:47570476-47570498 CAGGTGCAGCTAGCGGGAGGCGG + Intergenic
1185268666 22:49918459-49918481 GAGGGGCGGGGAGCGGGAGGCGG + Intronic
949232375 3:1766441-1766463 GGGGGTCAGGAAGTGGGAGGAGG + Intergenic
949556423 3:5157372-5157394 CAGGACCAGGAAGTGGGAGATGG - Intronic
949863666 3:8529415-8529437 GAGGTTCAGGAAGCGAGAGTTGG - Intronic
950053430 3:10008562-10008584 CAGGGTCAGATAGTGGGGGGTGG + Intronic
950278951 3:11689320-11689342 CAGAGATAGGAAGCGGGACGAGG - Intronic
950305068 3:11910847-11910869 CAGGGTCAGATAGTGGGGGGTGG + Intergenic
950386420 3:12663883-12663905 GCGGGTGAGGGAGCGGGAGGCGG + Exonic
951217831 3:20040863-20040885 GAGAGGCAGGAGGCGGGAGGCGG - Intronic
951524452 3:23640243-23640265 GAGGGTAAGGAAGCAGGAGGTGG + Intergenic
952210699 3:31226538-31226560 CAGGGCCAGGAAGCTGCAGGTGG + Intergenic
952224638 3:31362817-31362839 CAGGGCCAGGGAGTGGGGGGTGG + Intergenic
953030647 3:39177750-39177772 CAGGGGCGGGAGGCGGGAGGCGG - Intergenic
953544935 3:43857515-43857537 CAGGAGCAGGCAGCAGGAGGTGG - Intergenic
953545012 3:43857995-43858017 CAGGGCTAGGTAGAGGGAGGAGG + Intergenic
953720443 3:45350176-45350198 CCGGGTCGGGGAGCGGGAGGCGG - Intergenic
953881041 3:46691514-46691536 GAGGGACAGGAAGCCTGAGGAGG - Intronic
954091499 3:48287915-48287937 GAGAGTGAGGAAGGGGGAGGAGG + Intronic
954130727 3:48559375-48559397 GAGGGTCAGGAAGAGGGAGAAGG + Intronic
954218221 3:49136153-49136175 AAGGGCCAGGAGGCTGGAGGTGG - Intergenic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
954266223 3:49472175-49472197 GAGTGGCAGGAAGAGGGAGGGGG + Intronic
954432955 3:50480926-50480948 AAGGGGGAGGAAGGGGGAGGAGG + Intronic
954876534 3:53806212-53806234 AAGGGAGAGGAAGGGGGAGGAGG - Intronic
955417730 3:58708375-58708397 CAGGGGCAGGAAGTGGGTGAGGG - Intergenic
956280170 3:67547513-67547535 AAGGGTCAGGAACCTGGAAGAGG - Intronic
957024486 3:75166003-75166025 GAGAGACAGGAAGCTGGAGGGGG + Intergenic
957125250 3:76151290-76151312 AAGGGACAGGAAGAGAGAGGTGG - Intronic
960473468 3:118095461-118095483 CAGGGTCTGTCAGGGGGAGGGGG - Intergenic
960628302 3:119702895-119702917 CAGGGTCAGGAGGAGAGTGGAGG - Intergenic
960948670 3:122984213-122984235 CAGGGATTGGAAGCTGGAGGCGG + Intronic
961034748 3:123634605-123634627 CCTGGTCAGGAAGAGGCAGGAGG + Intronic
961372222 3:126438475-126438497 CATTGTCATGAAGAGGGAGGAGG + Intronic
961464327 3:127072239-127072261 CTGGGGCAGGAGGCGAGAGGAGG + Intergenic
961574263 3:127822433-127822455 CAGGGTCTGGGTGCGGGAAGAGG - Exonic
961649370 3:128409851-128409873 CAGGGCCAGGTAGGGTGAGGAGG - Intergenic
961679968 3:128593050-128593072 CGGGGTCAGGCCACGGGAGGAGG + Intergenic
961786164 3:129348097-129348119 CAGGACCAGGAAGCAAGAGGCGG + Intergenic
964431641 3:156612927-156612949 CAGGGGCTGGAGGTGGGAGGAGG - Intergenic
964571019 3:158107047-158107069 CGGGGTCAGGATGCGGGAATGGG - Intronic
965608735 3:170522623-170522645 CAGGGGCTGGGAGTGGGAGGAGG + Intronic
965786247 3:172338356-172338378 CAGAGGCAGGAAGGGGAAGGTGG + Intronic
966884992 3:184372593-184372615 AAGGGTCAGGAAGCAGGGGGTGG + Exonic
966917050 3:184590850-184590872 CGGGAGCAGGAAGCAGGAGGGGG - Intronic
967277968 3:187795259-187795281 CATGGGAAGGAAGAGGGAGGAGG + Intergenic
968478210 4:822543-822565 CAGGGTCGGGGAGGGGGAGCTGG - Intronic
968480462 4:830863-830885 CATGCCCAGGAAGTGGGAGGAGG + Intergenic
968629816 4:1644554-1644576 CAGGGACAGGGGGCGCGAGGCGG - Intronic
968789181 4:2647676-2647698 CAGGGGTGGGAAGCGGGGGGAGG - Intronic
968952044 4:3700306-3700328 GAGGGGGAGGAAGTGGGAGGAGG + Intergenic
968997604 4:3955534-3955556 CAGGGTCAGGAGGAGAGTGGTGG + Intergenic
969115697 4:4869458-4869480 GGGGTTCAGGGAGCGGGAGGAGG + Intergenic
969600557 4:8173700-8173722 CAGGGTCATGGAACCGGAGGTGG + Intergenic
970738995 4:19210655-19210677 GAAGGTTAGGAAGTGGGAGGTGG + Intergenic
971495950 4:27265401-27265423 AAGGGTCAGGAATCTGGAAGTGG - Intergenic
972900487 4:43675858-43675880 GTGGGTCAGGAATCTGGAGGTGG - Intergenic
973334802 4:48945051-48945073 CAGTGGCAGGAAATGGGAGGTGG + Intergenic
975896185 4:79093768-79093790 CAGGGGCAGGATGTGGGGGGAGG - Intergenic
979482687 4:121237904-121237926 GAGGGAGAGGAAGCGGGAGAGGG - Intergenic
979548870 4:121967668-121967690 TGGGGGCAGGAAGCGGGAGAAGG + Intergenic
980260041 4:130436976-130436998 CAGGGCCTGGCAGGGGGAGGGGG - Intergenic
980320530 4:131267048-131267070 CAGGTTCAGGAAAAGGGAGTGGG + Intergenic
980752196 4:137105831-137105853 GATGGTCATGAAGTGGGAGGAGG - Intergenic
981069679 4:140521861-140521883 CGGGGACAGGAAGGGGGAAGGGG + Intergenic
981475211 4:145180495-145180517 GAGGGGCAGGGAGCGGGTGGGGG + Intergenic
982914022 4:161181960-161181982 CAGGGTCAGGAAAGAGGAAGTGG + Intergenic
983216443 4:165007026-165007048 GAGGGGCAGGGAGCAGGAGGTGG + Intergenic
983906205 4:173184616-173184638 CAGGGAGAGGGAGAGGGAGGGGG + Intronic
985563700 5:604655-604677 CAGGGGCAGGAGGGGGGACGTGG + Intergenic
985671019 5:1206727-1206749 CAGGGACACGCAGCGTGAGGAGG + Intronic
986006266 5:3671699-3671721 CAGGGTTAGGAGGTGGGAGTCGG - Intergenic
986348842 5:6858610-6858632 CAGGGTCAGGAAGTGGCAGTTGG - Intergenic
986691226 5:10315545-10315567 GAGGGTCAGGAATCTGGGGGTGG - Intergenic
988297933 5:29390531-29390553 CAGGTTCAGGAAGGGGAGGGTGG - Intergenic
990524182 5:56608382-56608404 CAGGGGCAGGGAGCGGGGGATGG + Intergenic
995061110 5:107812773-107812795 CAGAGTCAGGAGGTGAGAGGAGG - Intergenic
995307575 5:110671733-110671755 CAGGGTCAGTCAGTGGGTGGGGG + Intronic
995669009 5:114578958-114578980 CAGGGACTAGAAGAGGGAGGAGG - Intergenic
996131483 5:119786933-119786955 AAGGGTAAGGAAGAGGGAGCAGG - Intergenic
997180108 5:131819452-131819474 CAGGGGGAGGGAGGGGGAGGGGG + Intronic
997295659 5:132766764-132766786 CGGGGTCAGGAACCGACAGGGGG + Intronic
997477287 5:134151242-134151264 CAATGTCAGGAAGCGGGGTGGGG + Exonic
998004611 5:138648786-138648808 AAGGTTCAGGAAGAGGCAGGCGG + Intronic
998135286 5:139671284-139671306 CAGGGGCTGGAGGTGGGAGGAGG - Intronic
998369476 5:141651497-141651519 CAGGGCGCGGAAGCGAGAGGGGG + Intergenic
999141114 5:149362793-149362815 CAGGCTCAGGGAGTGGAAGGAGG - Exonic
1000173584 5:158728141-158728163 CAGGGTCAGGAAGTGGCGGATGG - Intronic
1001420040 5:171579290-171579312 AAGGGTCAGGAAGGGGAAGAGGG - Intergenic
1002006502 5:176238693-176238715 CAGGGGCGGGAAGCGGGCGGCGG - Intronic
1002168184 5:177360947-177360969 AAGGGTCTGCAAGCTGGAGGAGG + Intronic
1002172391 5:177382696-177382718 CAAGATCAGGAAGAAGGAGGAGG + Intronic
1002219876 5:177671943-177671965 CAGGGGCGGGAAGCGGGCGGCGG + Intergenic
1002916764 6:1535405-1535427 CTGGGGCAGGAAGCGGAGGGTGG + Intergenic
1003125953 6:3356077-3356099 GAGGGGGAGGAGGCGGGAGGAGG + Intronic
1004060995 6:12197931-12197953 GGGGGTGAGGAAGAGGGAGGAGG + Intergenic
1004426830 6:15512405-15512427 CGGGGGCAGCAAGCGGGAGGAGG - Intronic
1005406901 6:25498995-25499017 CAAGGTCAGGGAGTGGGAGGAGG + Intronic
1005805572 6:29471423-29471445 GATGGGCAGGAAGAGGGAGGAGG + Intergenic
1006160554 6:32038506-32038528 CCGGGGCAAGAGGCGGGAGGTGG - Exonic
1006391076 6:33759026-33759048 CAGAGGCAGGATGGGGGAGGAGG + Intergenic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1006941600 6:37755348-37755370 CTGGGTCAGGCAGCAGGAGATGG + Intergenic
1007166211 6:39830709-39830731 CAGGCCCAGGCAGCAGGAGGGGG + Intronic
1007293568 6:40804755-40804777 CAGGGTGAGGAAGGGACAGGAGG - Intergenic
1007402187 6:41609127-41609149 CAAAGTCAGGAAGCTGGGGGTGG - Intergenic
1007406027 6:41637001-41637023 CCGTGCCAGGAAGCGGGAGTTGG + Intronic
1007740188 6:44005172-44005194 CAGGGGGAGGGAGAGGGAGGAGG + Exonic
1007926042 6:45650597-45650619 GAGAGTCAGGGAGAGGGAGGGGG + Intronic
1008457371 6:51726565-51726587 CTGGCCCAGGAAGCTGGAGGGGG - Intronic
1008863238 6:56176912-56176934 AAGGGGGAGGAAGGGGGAGGAGG + Intronic
1010042074 6:71396769-71396791 AAGGGGTAGGAAGAGGGAGGAGG - Intergenic
1011108584 6:83811385-83811407 GAGGGGCAGGAAGGGAGAGGAGG - Intergenic
1011148824 6:84245603-84245625 CAGGGACAGGGAGAGGGAGAGGG + Intergenic
1011464510 6:87641496-87641518 TAGTGTCAGGATGGGGGAGGAGG - Intronic
1015185306 6:130408933-130408955 CAGGGTCAGGGAGGGGGTGGTGG - Intronic
1015208185 6:130666027-130666049 CAGGGGCAGGAAGACAGAGGTGG - Intergenic
1015309818 6:131754517-131754539 TAGGGTCAGGTAGCTAGAGGGGG + Intergenic
1015868689 6:137753919-137753941 TAGGATAAGGAAGCTGGAGGAGG + Intergenic
1015982637 6:138854491-138854513 CAGGTTCAGAAGGCGGCAGGGGG - Intronic
1016396770 6:143632071-143632093 CAGGGCCAGGGAGGGGCAGGGGG - Intronic
1016923225 6:149317096-149317118 CCGGGTCCGGAAGTGGGTGGCGG - Intronic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017159163 6:151349324-151349346 CAGTTTCAGGAAGCCGAAGGAGG + Exonic
1017896773 6:158686862-158686884 CAGGGCCAGGAGGAGGGAGAAGG - Intronic
1017953790 6:159161121-159161143 CAGTGTTAGGAAGCTGGAAGTGG - Intergenic
1018673434 6:166198206-166198228 CAGAGTCAGGATGGTGGAGGAGG - Intergenic
1019019067 6:168902549-168902571 CAGGGTGAGGAGGCGGGGAGGGG + Intergenic
1019412212 7:911553-911575 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019412227 7:911583-911605 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019412242 7:911613-911635 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019412257 7:911643-911665 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019412272 7:911673-911695 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019412287 7:911703-911725 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019412302 7:911733-911755 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019412317 7:911763-911785 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019412332 7:911793-911815 GAGGGCCAGGAAGGGGGCGGGGG + Intronic
1019543095 7:1560246-1560268 CAGGGACAGGAGCAGGGAGGTGG - Intronic
1020026373 7:4902863-4902885 TGGGCTCAGGAAGTGGGAGGTGG - Intergenic
1023058322 7:36307254-36307276 CAGGGTTTGGAAGAGGGAGGAGG - Intergenic
1024663314 7:51520458-51520480 GAGGGTCAGGAATCCAGAGGTGG + Intergenic
1024993532 7:55254547-55254569 GAGGGCCCGGGAGCGGGAGGTGG - Intronic
1026734153 7:72938636-72938658 CGGTGTCTGGGAGCGGGAGGAGG - Exonic
1026996182 7:74618202-74618224 CTGGGTCAGAAAGGAGGAGGGGG - Intergenic
1027171708 7:75877637-75877659 AAGGGACAGGAAACGGGAGAGGG - Intronic
1028935217 7:96456511-96456533 CAGGTTCAGGAATCGAGGGGTGG + Intergenic
1029435605 7:100562484-100562506 CAGGGTGAGTAAGGGAGAGGAGG - Intronic
1029440681 7:100585225-100585247 CAGGCTTAGGAAGGAGGAGGAGG + Intronic
1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG + Exonic
1029704728 7:102270243-102270265 CAGGGTGAGGCAGCCGGTGGGGG + Intronic
1029708307 7:102286771-102286793 CGGGGCCAGGACGCGCGAGGGGG + Intronic
1030774002 7:113511351-113511373 CAGGGGCAGGAAGCGAGTGGTGG - Intergenic
1032174524 7:129612207-129612229 CCGGGCCCGGGAGCGGGAGGTGG + Intronic
1032492396 7:132333388-132333410 CAGGAAGAGGAAGAGGGAGGTGG + Intronic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034282527 7:149864113-149864135 CAGGCTCAGGAAGGAGGAGATGG + Exonic
1034430269 7:151037777-151037799 CTGTCCCAGGAAGCGGGAGGCGG + Intronic
1034433246 7:151051268-151051290 CCGGGCCAGGAAGCGCGCGGCGG - Exonic
1034527769 7:151676434-151676456 GATGGTCAGGAAAAGGGAGGGGG + Intronic
1034547892 7:151800935-151800957 CAGGGTCAGGGAGGGGCAGATGG + Intronic
1034911849 7:155003496-155003518 CAGGGCCAAGAAGCCCGAGGAGG - Intergenic
1035695272 8:1591293-1591315 CAGCGTTAGGAAGAGGGAGGGGG - Intronic
1036481075 8:9140110-9140132 TGGGGTCAAGAAGCGGGAGGAGG + Exonic
1036688493 8:10926844-10926866 GAGGCTCAGGAAGAGGAAGGGGG + Intronic
1036707005 8:11053566-11053588 CAGAGTCAGGAAGTGGGTGCAGG - Intronic
1037272367 8:17144062-17144084 CAGTGTCAGGCTGAGGGAGGTGG + Intergenic
1038675202 8:29616676-29616698 CTGGGTAAGGAAGTGGGAGTGGG + Intergenic
1038781807 8:30574681-30574703 GAGGGTCAGGAAGAGGTAAGTGG - Intergenic
1038795238 8:30703782-30703804 CAGGGGAAGGAAGAAGGAGGAGG + Intronic
1039619352 8:38982305-38982327 CAGGGGCTGGAGGTGGGAGGTGG + Intronic
1039848342 8:41342079-41342101 GAGGGCCAGGAAGAGAGAGGGGG + Intergenic
1040043698 8:42940513-42940535 CAGGGACAGGGAGAGGGAGAGGG + Intronic
1040595681 8:48835322-48835344 CAGGGTCAGCATGCTCGAGGGGG - Intergenic
1040618894 8:49066869-49066891 CAGAGCCAGGACACGGGAGGAGG - Intronic
1041826719 8:62102815-62102837 CAGTGTCAGGAATCAGAAGGGGG + Intergenic
1042236032 8:66613601-66613623 GCGGGTCCGGAAGCGGGCGGTGG + Intronic
1042965814 8:74350679-74350701 CGGGGTCAGGACACTGGAGGCGG - Intronic
1047214296 8:122864202-122864224 GAGGGACAGGCAGTGGGAGGAGG + Intronic
1047624342 8:126640791-126640813 CAGGGGCAGGTAGAGGAAGGAGG - Intergenic
1048260106 8:132938037-132938059 CAGAGCCAGGAAGAGGGAGGCGG - Intronic
1048987753 8:139744364-139744386 CAGGGTCTGGAAGCGGGGAAGGG - Intronic
1049147336 8:141010781-141010803 CAGGGACATGAAGTGGAAGGGGG + Intergenic
1049171911 8:141166825-141166847 CAGGGCCAGGGATGGGGAGGGGG + Intronic
1049240552 8:141535561-141535583 CTGAGTCGGGGAGCGGGAGGAGG - Intergenic
1049686533 8:143941419-143941441 CAGGGTCAGGAATGGGGCAGGGG + Intronic
1049699673 8:144004504-144004526 CAGTGTGAGGTACCGGGAGGTGG - Intronic
1051166408 9:14266720-14266742 GAGGGTAAGGGAGAGGGAGGAGG - Intronic
1051288673 9:15523326-15523348 AAGGGTTAGGAATTGGGAGGAGG - Intergenic
1051659106 9:19409254-19409276 CAGCGTCTGGAAGCTGGACGTGG + Intronic
1051667430 9:19478199-19478221 CAGGGGAAGGAACCGGGAGAGGG + Intergenic
1052022150 9:23537898-23537920 AAGGGTAAGGGAGGGGGAGGGGG + Intergenic
1052277336 9:26692045-26692067 CAGGGGTTGGAAGCTGGAGGAGG + Intergenic
1052994143 9:34540891-34540913 CAGGGTCAGGAAGATGGCTGTGG + Intergenic
1053004740 9:34596962-34596984 CAGGGAGAGGGAGTGGGAGGTGG + Intergenic
1053020230 9:34689415-34689437 CAGGAATAGGAAGGGGGAGGTGG - Intergenic
1053130191 9:35610145-35610167 CAGTTTCAGGAAGAGGGAGCAGG + Exonic
1053135746 9:35649491-35649513 CAGGCACAGGAAGTGGGCGGTGG - Exonic
1055249449 9:74284747-74284769 CAGTGTCTGGAAGCTGGAAGGGG + Intergenic
1056067095 9:82947772-82947794 CTGGGGCAGGAAATGGGAGGAGG - Intergenic
1056468918 9:86886301-86886323 CAGGTCCAGGAAGAGGGAAGTGG + Intergenic
1057034801 9:91804225-91804247 CAGGCTCAGGAACTGGCAGGAGG + Intronic
1057390836 9:94640214-94640236 GGGGGTCAGGATGCGGGCGGTGG - Exonic
1060747413 9:126146617-126146639 CAGGGTCGGGAAGCGGGCCCCGG - Intergenic
1060826559 9:126691151-126691173 CAGGTCCTGGAAGCAGGAGGTGG - Intronic
1060944546 9:127562187-127562209 CGGGGAGAGGAAGTGGGAGGAGG - Intronic
1060983538 9:127807234-127807256 GAGTGTCAGGAAGCGGAAGTAGG - Exonic
1061001120 9:127903635-127903657 GAGGCTCAGGAAGCGGATGGAGG - Intronic
1061202576 9:129146212-129146234 CGGGAGCAGGGAGCGGGAGGTGG - Intronic
1061215199 9:129217739-129217761 CAAGGTCAGGAAAGGGCAGGTGG + Intergenic
1061237625 9:129351834-129351856 CAGGGCCAGCAAGGGGGAGCCGG - Intergenic
1061280015 9:129592472-129592494 CAGGGTCTGGATGCGGGAAGGGG + Intergenic
1061432131 9:130537666-130537688 CGAGGTCTGGAAGCGGGAAGTGG - Intergenic
1061886978 9:133596098-133596120 CATGGTCATCAAGAGGGAGGAGG + Intergenic
1061931496 9:133835377-133835399 CAGCCTCAGGAAGCGGGGAGAGG + Intronic
1062139302 9:134947202-134947224 GTGGGTGAGGAAGCGGGGGGGGG - Intergenic
1062289874 9:135789675-135789697 CAGGGTTAGGAAGCGGGTTGGGG + Intronic
1062403534 9:136382861-136382883 CAGGCTCACGAGGAGGGAGGAGG + Intronic
1062537035 9:137025596-137025618 CTGGCTCAGGGAGCGGGTGGAGG - Intronic
1062555858 9:137113169-137113191 GCGGGTCAGGCAGTGGGAGGCGG + Intronic
1062590335 9:137271799-137271821 CAGGGACAGGAGGAGGGTGGAGG - Intronic
1203759370 EBV:4116-4138 CACGGTCATGAAGTTGGAGGCGG - Intergenic
1185449560 X:275222-275244 CAGGGGGAGGAAGGAGGAGGGGG + Intergenic
1185610905 X:1393011-1393033 AAGGGAGAGGAGGCGGGAGGAGG - Intergenic
1186655245 X:11605135-11605157 AAGGGACAGGAGGAGGGAGGGGG + Intronic
1186871774 X:13781044-13781066 CAGTGGGAGGAAGTGGGAGGTGG - Intronic
1187475750 X:19609389-19609411 CAGGGTCAGGATGCCTGAAGTGG - Intronic
1187505375 X:19874699-19874721 GAGGGTCAGGAGGCTGGGGGTGG + Intronic
1189037157 X:37505249-37505271 TAGGGTCCCGAAGCGGGCGGCGG - Intronic
1189119491 X:38379030-38379052 AAGGGTCAGGCAGGGAGAGGTGG + Intronic
1189364738 X:40379943-40379965 CAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1189377139 X:40474886-40474908 CAGGGGCAGGAAGAGGGAGAAGG + Intergenic
1190311470 X:49119818-49119840 CAGGTTCAGGTAGAGGAAGGAGG + Intronic
1190339158 X:49282696-49282718 CAGGGGCAGAACGAGGGAGGGGG + Intronic
1192074792 X:67982479-67982501 CAGGGGCATGATGGGGGAGGTGG + Intergenic
1192551185 X:72055013-72055035 GGGGGTTAGGAAGCGGGAGACGG - Intergenic
1193397748 X:81005155-81005177 CAGGTTCAGAAAGCTGGAGCTGG + Intergenic
1194714856 X:97276283-97276305 CAGGGACAGGGAGAGGGAGAGGG + Intronic
1195234045 X:102879531-102879553 CAGGGTCAGGAAGGCGGGTGGGG - Intergenic
1195300894 X:103528793-103528815 CAGGGTCAGGAATGGGGCTGGGG + Intergenic
1197112677 X:122795291-122795313 AAGGGTCAGGGAGAGGGAGGAGG + Intergenic
1198416883 X:136429380-136429402 CAGGGGCAGGAGCAGGGAGGTGG - Intergenic
1199760221 X:150899015-150899037 CAGTGCCGGGGAGCGGGAGGCGG + Intergenic
1199966474 X:152824723-152824745 CTGGCCCAGGAAGCTGGAGGGGG - Intergenic
1200072010 X:153533849-153533871 CAGGGGCAGGGACCGGGTGGGGG + Intronic
1200136139 X:153875664-153875686 CAGGGTCCGGAACAGGGAGAAGG + Intronic
1200224538 X:154409840-154409862 CAGGGTCTGTGAGCAGGAGGTGG + Intronic
1202379149 Y:24261047-24261069 CAGAGTCAGGGAGATGGAGGTGG - Intergenic
1202491633 Y:25409074-25409096 CAGAGTCAGGGAGATGGAGGTGG + Intergenic