ID: 1062825650

View in Genome Browser
Species Human (GRCh38)
Location 10:566613-566635
Sequence GCCCCAGCACACAGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062825647_1062825650 -3 Left 1062825647 10:566593-566615 CCAGAGGCGAGGGCCCATGAGCC No data
Right 1062825650 10:566613-566635 GCCCCAGCACACAGAAGCCCAGG No data
1062825640_1062825650 13 Left 1062825640 10:566577-566599 CCTTTTCCTGCCCTCTCCAGAGG No data
Right 1062825650 10:566613-566635 GCCCCAGCACACAGAAGCCCAGG No data
1062825646_1062825650 2 Left 1062825646 10:566588-566610 CCTCTCCAGAGGCGAGGGCCCAT No data
Right 1062825650 10:566613-566635 GCCCCAGCACACAGAAGCCCAGG No data
1062825643_1062825650 7 Left 1062825643 10:566583-566605 CCTGCCCTCTCCAGAGGCGAGGG No data
Right 1062825650 10:566613-566635 GCCCCAGCACACAGAAGCCCAGG No data
1062825645_1062825650 3 Left 1062825645 10:566587-566609 CCCTCTCCAGAGGCGAGGGCCCA No data
Right 1062825650 10:566613-566635 GCCCCAGCACACAGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062825650 Original CRISPR GCCCCAGCACACAGAAGCCC AGG Intronic