ID: 1062826349

View in Genome Browser
Species Human (GRCh38)
Location 10:571554-571576
Sequence ATGGGGAAGTGCAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 1, 2: 2, 3: 48, 4: 563}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062826349_1062826357 17 Left 1062826349 10:571554-571576 CCTTCCTCACTGCACTTCCCCAT 0: 1
1: 1
2: 2
3: 48
4: 563
Right 1062826357 10:571594-571616 TTCTCAGTCAGGTCAGTAGAGGG No data
1062826349_1062826355 6 Left 1062826349 10:571554-571576 CCTTCCTCACTGCACTTCCCCAT 0: 1
1: 1
2: 2
3: 48
4: 563
Right 1062826355 10:571583-571605 CAGCTGACACATTCTCAGTCAGG No data
1062826349_1062826356 16 Left 1062826349 10:571554-571576 CCTTCCTCACTGCACTTCCCCAT 0: 1
1: 1
2: 2
3: 48
4: 563
Right 1062826356 10:571593-571615 ATTCTCAGTCAGGTCAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062826349 Original CRISPR ATGGGGAAGTGCAGTGAGGA AGG (reversed) Intronic
900101735 1:964831-964853 GTGGGGATGTGCTGTGAGAAGGG + Intronic
900636797 1:3669837-3669859 GTGGGGATTTGCTGTGAGGAGGG + Intronic
901126201 1:6930572-6930594 CTGGGGAACAGCAGTGATGAGGG - Intronic
901352839 1:8613511-8613533 TTGGGGAAGTTCTGTGAGGGTGG - Intronic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903839489 1:26228100-26228122 ATGGGGAGGTGCAGAGGGTATGG + Intergenic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
904498084 1:30898688-30898710 GTGGGGAAGGGCAGGCAGGACGG - Intronic
904832017 1:33311513-33311535 AGAGGGAAGTGAAGAGAGGAAGG - Intronic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
904983354 1:34524848-34524870 ATGGGGAAGAAAGGTGAGGATGG - Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905403592 1:37719234-37719256 AGGAGGATGTGCAGTGAGGTGGG + Intronic
905683376 1:39890616-39890638 TTGGGGAAGAGCAGTTAAGAAGG - Intergenic
906260955 1:44389621-44389643 ATGGGGAAGTGAAGACAAGAAGG + Intergenic
907329907 1:53663983-53664005 TTGGGCAAGAGCAGTCAGGAGGG - Intronic
907663450 1:56414496-56414518 ATGGGGCAGTGGAGGGGGGATGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
910005516 1:82391349-82391371 ATGGGGTAGAGAAGTGTGGAGGG + Intergenic
910504787 1:87937624-87937646 AGGGGGAAGTGCAGTGAGGAAGG + Intergenic
912783409 1:112574794-112574816 ATGGGAAAGGGCAGTCAGGTAGG + Intronic
912946731 1:114091381-114091403 ATGGGGAAAGCCAGCGAGGAAGG + Exonic
912949461 1:114110782-114110804 CTGAGGTAGTGCAGCGAGGATGG - Intronic
913058551 1:115183917-115183939 AAGTGGAAGTGAAGAGAGGAAGG - Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914343030 1:146776427-146776449 ATGTGGAAGTGCATGGATGAAGG + Intergenic
914508880 1:148313313-148313335 ATGAGGAATTGCAGTGTTGATGG + Intergenic
915059637 1:153170774-153170796 GTGGGGAGGTGCAGGGAGGTAGG - Intergenic
915072252 1:153280021-153280043 ATGGGGAGATGCAGAGAGAAGGG + Intergenic
915165924 1:153947754-153947776 AAGGGGAAGAGTGGTGAGGAGGG + Exonic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915879361 1:159650036-159650058 ATGGAAAAGTGTAGTGGGGAAGG - Intergenic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916314006 1:163427506-163427528 AGGGGGAGGGGCAGTGGGGAAGG - Intergenic
917804380 1:178599977-178599999 ATGGGGGGGTGAAGTGGGGAAGG - Intergenic
917916667 1:179709090-179709112 GTGGGGGAGTGCAGTGAATAAGG - Intergenic
918300746 1:183201469-183201491 ATGGGGAAATGGAGTTAGGGAGG - Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
919802326 1:201361390-201361412 ATGGGGAGGTCCAGTAAGAAAGG + Intronic
919963398 1:202495510-202495532 CTGGGGATGTGCACTGTGGAGGG - Intronic
919996571 1:202757064-202757086 ATGGGGAAGGGCAGGGCGCAAGG + Intronic
920029474 1:203027811-203027833 ATGGGGATGGGCGGTGAGAAGGG - Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
921358926 1:214312695-214312717 GTGGCTAAGTGCAGTGAGGCAGG + Intronic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
922212661 1:223497635-223497657 ATGGGGGTGTGCTGGGAGGAGGG + Intergenic
922428029 1:225517746-225517768 ATGGGGAAGAACAGGGTGGAAGG + Intronic
922466525 1:225848696-225848718 GTGGGGGAGTGCAGGGATGAGGG + Intronic
922887216 1:229029286-229029308 GTGGGGAAGGCAAGTGAGGACGG - Intergenic
922994517 1:229945189-229945211 ATGGGGAATTGGGGTGAGGAGGG - Intergenic
923852780 1:237815620-237815642 ATGAAGGAGAGCAGTGAGGAAGG + Intronic
924365380 1:243287827-243287849 AAGGGGAAGTGAAGTGAGAAAGG + Intronic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1062787787 10:279643-279665 AAGGGGCAGTGCAGGGAGGCTGG + Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1062901225 10:1148157-1148179 ATGGGGAGGAGCAGGGAGGGAGG + Intergenic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1064336557 10:14448472-14448494 ACGGGGAAGAGCAGGGAGGGTGG - Intronic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1064766722 10:18682869-18682891 ATGGTGGAGTGATGTGAGGAAGG - Intergenic
1065495137 10:26319801-26319823 ATGGGGACCAGAAGTGAGGAGGG + Intergenic
1066303736 10:34119114-34119136 ATGGGTGAGAGCAGTGATGATGG + Intronic
1066338381 10:34504075-34504097 ATGTGGAAGTGCAGTGAGCATGG - Intronic
1066523815 10:36253385-36253407 ATGGGGAAGTAGTGTCAGGAAGG - Intergenic
1067181085 10:43986485-43986507 GTGGGGAAGGGCAGGGAGAATGG - Intergenic
1067455917 10:46419183-46419205 TTGGGGAGGGGCAGTGGGGACGG + Intergenic
1067631283 10:47965456-47965478 TTGGGGAGGGGCAGTGGGGACGG - Intergenic
1067658602 10:48216857-48216879 ATTGGGAAGTCCTGGGAGGAGGG - Intronic
1067936128 10:50613557-50613579 ATGTGGCAGGGCAGAGAGGATGG - Intronic
1068559630 10:58499093-58499115 ATGGCAAAGTGCAGTGAGAAAGG - Intergenic
1068701419 10:60024175-60024197 ATATGGAAGTGCAGTGGGGCTGG + Intergenic
1069016486 10:63434959-63434981 ATGAGGAAGTGTTGTGAGGAGGG - Intronic
1069342892 10:67433083-67433105 ATAGTTAAGTTCAGTGAGGAAGG - Intronic
1070411851 10:76149272-76149294 ATTAGGATGTGCTGTGAGGACGG + Intronic
1070961474 10:80502926-80502948 AGGAGGAAGAGCAGGGAGGAAGG + Intronic
1071371070 10:84952400-84952422 ATGGGGTGGTGGAGAGAGGAGGG + Intergenic
1071501702 10:86208634-86208656 ACAGGGAAGTGCAGTGAAGGGGG - Intronic
1072065358 10:91864154-91864176 ATGGGCAAGTGCAGTGAAACAGG + Exonic
1074015473 10:109529902-109529924 CTGGGGAAGTGCAGGGAACAGGG + Intergenic
1074495614 10:113977837-113977859 ATGGGAAAGAGGAGTGAGGTGGG - Intergenic
1075409831 10:122219217-122219239 TGGGGGGAGTGCAGTGAGGGTGG - Intronic
1075597029 10:123739574-123739596 CCAGGTAAGTGCAGTGAGGAGGG + Intronic
1075838620 10:125477723-125477745 GGGGGGAAGTGGAGTGGGGATGG + Intergenic
1076090831 10:127684235-127684257 AGTGGGAAATGCAGTGAGGGAGG - Intergenic
1076666971 10:132098752-132098774 AGGGGCATTTGCAGTGAGGAGGG + Intergenic
1077391335 11:2301949-2301971 AAGGGGAGGGGCAGTGAGGTTGG - Intronic
1077892245 11:6427650-6427672 ATGTGGGAGTGAAGTGAGGGAGG + Intergenic
1079105780 11:17571490-17571512 AAGGGGCAGTGAAGGGAGGAAGG - Intronic
1079536790 11:21524872-21524894 ATGAGGAATGACAGTGAGGAAGG + Intronic
1080132517 11:28813689-28813711 ATGGATAGGGGCAGTGAGGAGGG - Intergenic
1083707213 11:64524864-64524886 ATGGGGCAGGGCTGTGAGGGGGG - Intergenic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084671805 11:70611442-70611464 ATGGGGCATTGCAGGGAAGATGG - Intronic
1084779626 11:71399775-71399797 CTGGGGGAGGGCAGTGTGGAGGG + Intergenic
1084922717 11:72484119-72484141 AGGGTGAAGGGCAGTGAGCAAGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1085723877 11:78937141-78937163 ATGGGGAAGGGCAGTGATCCTGG + Intronic
1086944951 11:92835909-92835931 ATGGGGAAGGATGGTGAGGAGGG - Intronic
1087204621 11:95381033-95381055 ATGGGGCATTGCATAGAGGAGGG + Intergenic
1087777453 11:102269247-102269269 AGTGGGAAGTGCTGTGAGGGTGG + Intergenic
1088050281 11:105505966-105505988 ATTTGGAAGTGCCTTGAGGAAGG - Intergenic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1089998613 11:122932792-122932814 ATGGGGAAATGCGGGCAGGAAGG - Intronic
1090469619 11:126968793-126968815 ATGGGGCTCTGCAGTGAGAAAGG + Intronic
1090480225 11:127061407-127061429 ATAGGGAAGTGCACTGGGCAAGG - Intergenic
1090761468 11:129840408-129840430 ATGAGGAAGTGCAGGGAGGAGGG + Intronic
1091392652 12:135235-135257 AAGGGGAAATGTAGAGAGGAAGG - Intronic
1091607930 12:1972811-1972833 AGGGGGGAGATCAGTGAGGAAGG + Intronic
1091714931 12:2770263-2770285 ATGGGGAGGGGCAGCCAGGAAGG - Intergenic
1093221881 12:16431396-16431418 ATGATTAAGTTCAGTGAGGAAGG - Intronic
1093445395 12:19251074-19251096 ATTGGGAGGTGCTGGGAGGAAGG + Intronic
1093546878 12:20359204-20359226 ATGGAGCACTCCAGTGAGGAAGG + Intergenic
1095631696 12:44384401-44384423 GTGGGGAAGTGCAGAGGGGAAGG - Intronic
1095635522 12:44428889-44428911 TTGGGGAACTGCAGTGAGCAAGG + Intergenic
1095732273 12:45519053-45519075 ATGAGGAAGAGCAATGTGGAAGG - Intergenic
1096497504 12:52046979-52047001 GTGGGGAACTGCGGTGATGAGGG + Intronic
1097225513 12:57474974-57474996 CTGGGGAAGTAGAGTGAGGCGGG + Intronic
1097502138 12:60417966-60417988 ATGGGAAGGTGAAGAGAGGATGG + Intergenic
1100697277 12:97108976-97108998 AAGTAGTAGTGCAGTGAGGATGG - Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101540200 12:105658212-105658234 AAAGGTAAGTGTAGTGAGGATGG + Intergenic
1102076978 12:110067489-110067511 ATGGGAAAAGGAAGTGAGGAGGG - Exonic
1102760479 12:115380627-115380649 ATGGGGGAGTGAAGTGGAGAAGG + Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1103449165 12:121016159-121016181 ATGGGCAGGTGCAGTAGGGAGGG - Intronic
1103480958 12:121249424-121249446 TTGAGAAACTGCAGTGAGGATGG - Intronic
1103557583 12:121775586-121775608 CTGGGGGAGTCCAGAGAGGAGGG - Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103730175 12:123022149-123022171 GCGGGGAAGGGCGGTGAGGAGGG + Intronic
1103794550 12:123494414-123494436 ATGGGGCAGGGAAGAGAGGAGGG - Intronic
1103848817 12:123917940-123917962 ATTGGGATGTGCTGTGGGGAGGG + Intronic
1103871260 12:124093872-124093894 GTGGGGAAGTCAAGTGGGGAAGG + Intronic
1103929344 12:124440966-124440988 CTGGGGAGGGGCAGAGAGGACGG + Intronic
1104182225 12:126393274-126393296 CTGGGGAAGTGCAGTGAAACTGG + Intergenic
1104328828 12:127825498-127825520 CTGGGGCAGAGCAGTGAGGACGG - Intergenic
1106774061 13:32991486-32991508 AGCGGGAAGACCAGTGAGGAGGG + Intergenic
1106819485 13:33448260-33448282 GATGGGAAGTGTAGTGAGGAGGG - Intergenic
1107899840 13:45001199-45001221 AAGGAGAAGTGCAGAGAGAAAGG - Intronic
1108132731 13:47320542-47320564 ATTGGGATGGGCAGTTAGGAGGG + Intergenic
1109125965 13:58517302-58517324 ATGACTAAGTTCAGTGAGGAAGG + Intergenic
1109237996 13:59848086-59848108 ATCGGGAAGAGTAGTGAGGGTGG - Intronic
1109277143 13:60315489-60315511 AGGGGAAAGTTCATTGAGGATGG + Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110894264 13:80729423-80729445 GGGGTGAAGGGCAGTGAGGAAGG + Intergenic
1111213285 13:85108778-85108800 ATGGGAAGCTGCAGTGAGGCTGG - Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1112621510 13:101058375-101058397 AAGGGGAACTGCAGGAAGGAAGG + Intronic
1113223677 13:108134866-108134888 ATTGGCAAGGGCTGTGAGGAAGG - Intergenic
1113589882 13:111491090-111491112 AAGGGAGAGGGCAGTGAGGAAGG - Intergenic
1113853140 13:113429266-113429288 ATGGGGAGTTCCAGGGAGGATGG - Intronic
1114443339 14:22768606-22768628 TCGGGGTAGGGCAGTGAGGAGGG - Intronic
1114527718 14:23376986-23377008 ATGGGGAGGGGCAGAGAGGAAGG - Exonic
1115288201 14:31741235-31741257 ATGGGCAAGTGCAGGGGGCAGGG + Intronic
1115393447 14:32879415-32879437 ATGTGAATGTGCAGAGAGGAGGG - Intergenic
1117565073 14:56985731-56985753 ATAGGGAAGGGCAGTGCTGATGG + Intergenic
1117971476 14:61255016-61255038 GTGTGGGACTGCAGTGAGGATGG - Intronic
1118867683 14:69716212-69716234 GTGGGCAGGAGCAGTGAGGAGGG + Intergenic
1119529856 14:75352517-75352539 ATGGGGAAGGGAAGAGAGGGTGG - Intergenic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121186163 14:91971617-91971639 AAGGGGAAGGGAAGAGAGGAAGG + Intronic
1121617471 14:95322261-95322283 AAGGTGAAGTGCAGGGAGCAGGG - Intergenic
1122143057 14:99673888-99673910 CTGGGGGAGTGCACTGAGGGGGG + Intronic
1122412957 14:101535246-101535268 GTGGCCAAGTGCAGTGGGGATGG - Intergenic
1123035103 14:105468794-105468816 GTGGGGAAGGGCAGTGAGTGGGG + Intronic
1124203397 15:27697662-27697684 GTGGGGAAGTGGAGTGGGGGAGG - Intergenic
1124964103 15:34420510-34420532 ACGGGTCACTGCAGTGAGGATGG + Intronic
1124980716 15:34566738-34566760 ACGGGTCACTGCAGTGAGGATGG + Intronic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1125368329 15:38942924-38942946 AGGGAGAAGAGCAGGGAGGAAGG + Intergenic
1125882582 15:43207312-43207334 GTCTGGAAGTGCTGTGAGGATGG - Exonic
1127374715 15:58373913-58373935 AGGGGAAAGGGCAGAGAGGAGGG + Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127532140 15:59853784-59853806 ATGGGGAAGGACAGAGAGGAGGG - Intergenic
1128171376 15:65516986-65517008 ATGGGAGAGGGCAGTGAGCAGGG + Exonic
1128301139 15:66567095-66567117 ATGTGGAAGTGCAGGGTGGGAGG - Intergenic
1128304132 15:66586984-66587006 AGGGGGAAGGGAAGTGGGGAGGG - Intronic
1128561018 15:68667711-68667733 ATGGGAGAGTGCACTGAAGATGG + Intronic
1128751143 15:70150130-70150152 ATGGCGATGTGCAGAGTGGAAGG - Intergenic
1129343280 15:74900240-74900262 GTGGGACAGTGCAGTGAGGCAGG - Exonic
1129657949 15:77537155-77537177 TTGGGGAAGGGCAGGGAGTATGG - Intergenic
1129825597 15:78633050-78633072 ATAGGGAGGTGAAGTGAGGCTGG - Intronic
1130355452 15:83125902-83125924 ATGGGGAAGAGAAGTAAAGAAGG + Intronic
1130553244 15:84905330-84905352 ATGGGCCTGGGCAGTGAGGAGGG - Intronic
1130631586 15:85574808-85574830 ATGAGGAAGTGCAAGGAAGATGG - Intronic
1131833808 15:96370531-96370553 ATGGAGCAGTGCAGTGAGGTGGG - Intergenic
1132313917 15:100877479-100877501 GTGGTGCAGTGCAGGGAGGAGGG - Intergenic
1132839961 16:1974116-1974138 CTGGGGAAGGGCAGTGGGGCGGG + Intronic
1133601209 16:7341998-7342020 GGGGAGAATTGCAGTGAGGAGGG + Intronic
1133668115 16:7990709-7990731 GTTGGGAACGGCAGTGAGGAAGG - Intergenic
1133998715 16:10766397-10766419 AGGGGGAAATGCAGTTAGGAAGG + Intronic
1134040247 16:11062897-11062919 GTGGGGGAGGGCAGTGGGGAGGG + Intronic
1135089929 16:19505541-19505563 ATGGGGAAGTGAGGTGGGAAGGG + Intronic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135147468 16:19975016-19975038 CTGGGGAAGTGCAGGGTTGAGGG - Intergenic
1135587208 16:23680032-23680054 ATGGGGAGGTGGATTGAGGCCGG - Intronic
1136671475 16:31862402-31862424 AGGAGGCAGTGCAGTGAGGCAGG - Intergenic
1136689934 16:32021862-32021884 AGGGGAAAGTGCAGTGTGGTGGG - Intergenic
1136790519 16:32965423-32965445 AGGGGAAAGTGCAGTGTGGTGGG - Intergenic
1136879295 16:33888509-33888531 AGGGGAAAGTGCAGTGTGGTGGG + Intergenic
1137489848 16:48923263-48923285 AGGCTGAAGTGCAGTGAGGGAGG + Intergenic
1137789880 16:51166023-51166045 ATTGGGAAGTGGAGTGCAGATGG + Intergenic
1138351572 16:56348786-56348808 CTCGGGGAGGGCAGTGAGGAGGG - Intronic
1138509764 16:57501641-57501663 GTGGCTGAGTGCAGTGAGGAGGG + Intergenic
1139415477 16:66804998-66805020 AGGGGGAAGTAGAGTGAGGGAGG + Intronic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1139990956 16:70938901-70938923 ATGTGGAAGTGCATGGATGAAGG - Intronic
1141313208 16:82935210-82935232 ATGGAGAAGTGCAGAGTGAAGGG + Intronic
1141332004 16:83119353-83119375 ATGAGGAATTGCATTCAGGAGGG - Intronic
1141782075 16:86169234-86169256 AAGGGGATGAGAAGTGAGGAGGG + Intergenic
1141963366 16:87424436-87424458 CTGGGGAAGAGCAGTGAAAAGGG + Intronic
1203092722 16_KI270728v1_random:1226881-1226903 AGGGGAAAGTGCAGTGTGGTGGG - Intergenic
1142766076 17:2065021-2065043 ATGAGGTAGGGCAGTGGGGATGG + Intronic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143765524 17:9135142-9135164 ATGGGGTAGAGAAGGGAGGATGG - Intronic
1144032324 17:11333892-11333914 ATGTGGAGGCGCTGTGAGGATGG + Intronic
1144033367 17:11341977-11341999 ATGGGGAGGTGCAGAGAGGGTGG - Intronic
1144979349 17:19158948-19158970 ATGTGGAAGTGCAGAGGAGAAGG - Exonic
1144988873 17:19219284-19219306 ATGTGGAAGTGCAGAGGAGAAGG + Exonic
1145940059 17:28738646-28738668 GGGGAGAAGGGCAGTGAGGAAGG - Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146405217 17:32530918-32530940 ATGGTGAGTTGCAGTGAGGGAGG - Intronic
1146487909 17:33259014-33259036 GTGGGGAAGAGCAGAAAGGAAGG + Intronic
1146596476 17:34173404-34173426 GTGGGGAAATGCAAGGAGGAGGG + Intronic
1148664864 17:49366879-49366901 GTGAGGAAATGCAGTGAGCAGGG - Intergenic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1149369076 17:55975217-55975239 AAGGAAAAGTGTAGTGAGGAAGG + Intergenic
1149527113 17:57365401-57365423 AAGGGGAAGTTCAGTGGTGAAGG + Intronic
1150432680 17:65131023-65131045 ATGTGGAAGTGCAGAGATAAAGG + Intergenic
1151001237 17:70379386-70379408 ATGGTGAAGGTCATTGAGGATGG + Intergenic
1151188499 17:72381010-72381032 CTGGGGAAGTGCTGTCAGGCTGG + Intergenic
1151239107 17:72744025-72744047 ATGGGGAGGTGGAGAGAGGCAGG - Intronic
1151649341 17:75456679-75456701 GAGGGGACGTGAAGTGAGGAGGG + Exonic
1151861147 17:76763025-76763047 TTGGGGGAGTTCAGTCAGGATGG - Intronic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1156282416 18:35652765-35652787 AAGGTGAAGTGCAGTGAAGAGGG - Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156540279 18:37903036-37903058 GTGGAGAAGGGCAGTGATGATGG + Intergenic
1157337961 18:46755314-46755336 ATGGGGAAGTTTAGAGAAGAAGG + Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157914857 18:51654946-51654968 ATGGGGAGGCGGAGTGGGGAAGG - Intergenic
1158308593 18:56134075-56134097 ATTTGGAAGGGCAGTGAAGATGG + Intergenic
1158329625 18:56347271-56347293 AGGGGGAAAGGCAGTCAGGAGGG - Intergenic
1158631676 18:59120688-59120710 ATGGTGAATTTCAGTGAGGGTGG - Intergenic
1159435148 18:68406964-68406986 ACGGGGGAGTGCGGTGAAGATGG + Intergenic
1160053616 18:75459434-75459456 AAGGAGAAGTGCAGAGAGAAGGG + Intergenic
1160388166 18:78510479-78510501 CTAAGGAAGTGGAGTGAGGACGG + Intergenic
1160526416 18:79541068-79541090 ATGAGAAAGTGCAGTGCGGCTGG - Intergenic
1160573187 18:79832292-79832314 CTGAGGAAGGACAGTGAGGATGG - Intergenic
1160718380 19:586712-586734 CTGGGGAGGTTCAGCGAGGAGGG + Intergenic
1160924900 19:1539300-1539322 AAGGGAAAGGGCTGTGAGGAGGG - Intergenic
1161469331 19:4448405-4448427 GTGGAGAAGTGCTGGGAGGAGGG + Exonic
1162161930 19:8724609-8724631 TTTGGGAAGAGAAGTGAGGATGG - Intergenic
1162182052 19:8876616-8876638 ATGGTGAAGTTCAGTGTGAATGG + Exonic
1163401278 19:17094488-17094510 TTGGGGATGTGGAGTGGGGAGGG - Intronic
1163804208 19:19386239-19386261 AGGGGGAAGTGCTGTGGAGAAGG - Intronic
1165556975 19:36642526-36642548 ATGGGGAAGTGCAGGCAGGGAGG + Intronic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1166917749 19:46207167-46207189 ATGTGGAGGTGCTGAGAGGATGG - Intergenic
1167080508 19:47274022-47274044 ATGGGGAGGGGGCGTGAGGAGGG + Intergenic
1167626850 19:50596063-50596085 ATGATTAAGTTCAGTGAGGAAGG + Intergenic
1167903659 19:52640693-52640715 CTGGGGCAGCGCAGTGGGGAGGG - Intronic
926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG + Intergenic
926622624 2:15060615-15060637 CTGGGTCAGTGCAGGGAGGATGG + Intergenic
926660020 2:15454751-15454773 ATTGGGAAGTGGAGAAAGGAGGG - Intronic
926672288 2:15587699-15587721 CTGGGAAAGTGTAGAGAGGATGG - Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927083590 2:19653617-19653639 ATGGAGGAGGGCAGAGAGGATGG + Intergenic
927637569 2:24827367-24827389 CTGCAGCAGTGCAGTGAGGAGGG - Intronic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
929332836 2:40704706-40704728 ATGAGGCAGTACAGTGGGGACGG + Intergenic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
931224917 2:60321367-60321389 CTGGGGAAGTGCTGGGTGGAAGG - Intergenic
932062266 2:68515359-68515381 ATGGGGAATTGTAGTGGGGAGGG + Intronic
932062392 2:68519569-68519591 ATGGGGAATCGTAGTGGGGAGGG - Intronic
933036825 2:77410551-77410573 ATGGGAAAGTACATTGAGGATGG + Intronic
933539754 2:83624484-83624506 ATAGGGAAGTCCAGTGGAGAGGG + Intergenic
934070164 2:88376642-88376664 ATGGGGATTTGCAGCGAGTAGGG + Intergenic
934898682 2:98140269-98140291 ATGGGTCAGTGCTGGGAGGAAGG - Intronic
935393012 2:102573435-102573457 ACTGGGAAGTGTAGTGGGGAGGG - Intergenic
935452995 2:103232693-103232715 TTGGTTAAGTGAAGTGAGGATGG + Intergenic
935820854 2:106891195-106891217 ATGATGAAGTGCAGAGATGAGGG + Intergenic
937067556 2:119029371-119029393 ATGGCGAAGTGCAGGGACGGTGG + Intergenic
937174047 2:119908722-119908744 ATGATTAAGTTCAGTGAGGAAGG + Intronic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937911938 2:127080082-127080104 GGGGGTAGGTGCAGTGAGGATGG - Intronic
939353353 2:141069557-141069579 ATAGGGACGTGGAGTAAGGAAGG - Intronic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
941067455 2:160919430-160919452 ATGGGGAGGGGCCCTGAGGATGG - Intergenic
941686638 2:168455297-168455319 ATGGGGAAATGCATTGCGGGAGG + Intergenic
941795587 2:169595538-169595560 ATGGGGACTGGAAGTGAGGATGG - Intronic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942430875 2:175910131-175910153 ATGGGAAAGTATAGTGAAGAGGG - Intergenic
943666568 2:190615488-190615510 ATGTGGAGGTGCAGGGAGGCCGG - Intergenic
944108798 2:196108794-196108816 GTGGGGAACTGAGGTGAGGATGG - Intergenic
944260532 2:197671051-197671073 ATGTGGAATTGCAGTGAGAAGGG - Intronic
944810957 2:203327733-203327755 GTGGGGAAGTGCAAAGAGGCAGG + Intergenic
944976789 2:205062545-205062567 GAGTGGAAGTGCACTGAGGATGG + Intronic
944998754 2:205325039-205325061 CTAAGGAAGTGCAGTGAAGATGG - Intronic
945427430 2:209723787-209723809 ATGTGGAACAGCAGTGAGAAAGG - Intronic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945660429 2:212678827-212678849 AAGGAGAAGTGCAGTGAAAATGG - Intergenic
946164583 2:217856262-217856284 CAGGGGAAGTGATGTGAGGAAGG + Intronic
946441979 2:219704387-219704409 CTGGGGGAGGGCAGTGTGGAGGG - Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947448250 2:230181223-230181245 ATGAGGTAGTGAATTGAGGAAGG + Intronic
947552161 2:231053985-231054007 ATTGGGTAATGGAGTGAGGATGG + Intergenic
948173812 2:235927971-235927993 ATTGGGCATTGCAGTGTGGAAGG + Intronic
948663412 2:239520348-239520370 ACCCGGAAGTGCAGTGAGCAGGG - Intergenic
948670200 2:239563676-239563698 ATGGGCAGGTGCAGAGGGGATGG + Intergenic
948790713 2:240375276-240375298 ATGGGGAAGTGCATCGCGTAGGG - Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169424742 20:5487068-5487090 AGGGGGAATGGCAGGGAGGAGGG - Intergenic
1170703686 20:18726758-18726780 ACGGGGAAGAGCAGTGTGGTAGG - Intronic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1171447476 20:25214970-25214992 GTGGGGCTGTGCAGTGAGGTGGG + Intronic
1171486656 20:25490725-25490747 GTGGGGGACTGCAGTGAGAAGGG + Intronic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172598669 20:36168448-36168470 ATGGGAAGCTGCAGTGAGGAGGG - Intronic
1172941174 20:38655815-38655837 ATGGGGAAGTGAGGCGGGGAGGG + Intergenic
1173328043 20:42051398-42051420 ATGGGGAAGTGAGGCAAGGAGGG + Intergenic
1173569595 20:44067756-44067778 GAGGGAGAGTGCAGTGAGGAGGG + Intronic
1174136268 20:48382189-48382211 AGGGGGAAGAGCAGGGAGGCTGG + Intergenic
1174570474 20:51497679-51497701 AGGGGGAACTGCTGAGAGGAGGG + Intronic
1175072259 20:56344388-56344410 TTGGGGAAGTTAAGGGAGGATGG - Intergenic
1175166811 20:57049680-57049702 ATGGGGATCTGCATTGAGGATGG + Intergenic
1175278934 20:57789593-57789615 ATGGGGAAGTGATGTGAGAAAGG - Intergenic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175826927 20:61941610-61941632 CTGGGGAAATGAAGTGGGGAGGG - Intergenic
1176290825 21:5043725-5043747 CTGGGAGAATGCAGTGAGGAAGG + Intergenic
1176513268 21:7764399-7764421 ATGGGGAAGGCCAGAGAGGCTGG + Intronic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178647381 21:34394923-34394945 ATGGGGAAGGCCAGAGAGGCTGG + Intronic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1179300510 21:40104925-40104947 ATGGGGAAGTACATTCAGGGTGG + Intronic
1179818871 21:43924982-43925004 TGGCTGAAGTGCAGTGAGGAAGG - Intronic
1179866430 21:44219916-44219938 CTGGGAGAATGCAGTGAGGAAGG - Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1180593934 22:16961732-16961754 AAGGGGCAGAGCAGTGGGGAGGG - Intergenic
1180745771 22:18087977-18087999 TAGAGGAAGTGCAGGGAGGAAGG - Exonic
1181110551 22:20600384-20600406 ATGTGGAGGTGCAGGGAGCAGGG + Intergenic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1182650783 22:31849444-31849466 AAGGAGAAGTGCAGAGTGGAGGG + Intronic
1182660654 22:31922751-31922773 ATGAAGAACTGCAGTGAGGCTGG - Intergenic
1183008422 22:34924102-34924124 ATGATTATGTGCAGTGAGGAAGG - Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183318975 22:37153542-37153564 AGAGGGAAGGGCAGTGTGGAAGG - Intronic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184017197 22:41795228-41795250 ATGGGGAAGTGGGGTAAGTAAGG - Intronic
1184177384 22:42795919-42795941 AAGGGGAGGGGCAGTGGGGAGGG + Intergenic
1184980963 22:48096059-48096081 ATGGGGAGGTGCAGGCGGGATGG + Intergenic
1184980976 22:48096097-48096119 ATGGGGAGGTGCAGGCGGGATGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
949140228 3:623872-623894 ATAGGAAAGAGCACTGAGGAAGG - Intergenic
949409249 3:3745861-3745883 AAGGGGAAGTGGTGTTAGGAGGG - Intronic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
949940177 3:9148724-9148746 ATGGGGTAGTGGAGAAAGGATGG - Intronic
950126843 3:10514847-10514869 AGGGGGATGTGCAGTGAGAGAGG - Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950188618 3:10960816-10960838 ATGGGGTAGTGGAGTGTGGCAGG + Intergenic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950552337 3:13674284-13674306 ATGGGGAAAGGAAGTGAGGGAGG - Intergenic
950616519 3:14164368-14164390 AGGCAGCAGTGCAGTGAGGAGGG - Intronic
950947291 3:16962059-16962081 ATGGGGAAGCTCAGGGAGCATGG + Intronic
951297196 3:20952468-20952490 GTGGGGAAGGGTAGGGAGGAGGG + Intergenic
952109775 3:30109118-30109140 ATGGGGAACTGCAAAGGGGATGG - Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
953456752 3:43048488-43048510 ATGGGGAAGTGAAGCAGGGAAGG + Intronic
953457393 3:43053989-43054011 ATGAGGAATTGCAGTCTGGAGGG + Intronic
954007590 3:47604317-47604339 TTGGGGAAGTGCTGAGAGGAGGG - Intronic
954137330 3:48588041-48588063 ATGAGGAAGATCAGTCAGGAGGG - Intronic
954198337 3:49009224-49009246 ATGGGCAAGAGCATTGAGTATGG - Intronic
954848208 3:53578173-53578195 ATGGGCAAGTGCTGTTAGGGAGG + Intronic
954920586 3:54187559-54187581 ATGGGGACTGGCAGTCAGGAAGG + Intronic
955237124 3:57149383-57149405 ATGGGTAAGTACAGAGAAGAAGG - Intronic
955663453 3:61325978-61326000 ATGGGGGAGTCAAGAGAGGAAGG - Intergenic
955789539 3:62574089-62574111 CTGGGGAGTTGCAGTGGGGATGG - Intronic
955923756 3:63985682-63985704 GTGAGGAGGGGCAGTGAGGATGG - Intronic
957001803 3:74895209-74895231 ATGTGGCTGAGCAGTGAGGAGGG - Intergenic
957824495 3:85423069-85423091 ATGGGGAATTGGAGAGGGGATGG + Intronic
958164747 3:89865986-89866008 ATGAGGAAGTGTAGAGGGGAAGG - Intergenic
958914304 3:100031396-100031418 TTTGGGAAGTGGAGTGAGGAAGG + Intronic
959663007 3:108890311-108890333 TTGGGGAAGTCAAGTGAGAATGG + Intergenic
960947005 3:122973808-122973830 GTGGGGAAGGGCAGAGAGGGAGG + Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961106688 3:124248686-124248708 AATGGGAAATGCAGAGAGGAAGG - Intronic
961345308 3:126260187-126260209 AGGGGGAAGAGAAGGGAGGAAGG - Intergenic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961847573 3:129780067-129780089 ATGGGGAAATGGAGTTAGTATGG - Intronic
963940595 3:151092624-151092646 CTGGGGAAGTGGAGTGAGGGAGG + Intronic
965328258 3:167335047-167335069 TTGGGGTAGTGCAGTGTGCAAGG - Intronic
965448798 3:168810633-168810655 AAGTGGGAGTGCAGTGTGGAGGG + Intergenic
965601558 3:170459379-170459401 ATGAGGCAGTGTAGTGAGCAGGG + Intronic
966775834 3:183541987-183542009 AGGGGGAAGTGAGGTTAGGAGGG - Intronic
966940867 3:184746308-184746330 ATGGGGAGGTGGCGTGAAGAAGG - Intergenic
967095201 3:186172298-186172320 AAGGGGAAGTGGAGTGGGGGTGG - Intronic
967104159 3:186242108-186242130 TTGGGGAAGAGCAGGGAGGCTGG - Intronic
967299160 3:187995388-187995410 GTGGGGAAGTGCAGGGATGCAGG + Intergenic
967325816 3:188238454-188238476 ATGGTTAAGTTTAGTGAGGAAGG - Intronic
967766572 3:193286800-193286822 ATGGGTAAGCTTAGTGAGGAAGG + Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
969402437 4:6964412-6964434 CTGGGAAACTGCAGTCAGGAAGG - Intronic
969563546 4:7964541-7964563 ATGAGGAGGTACTGTGAGGAGGG + Intergenic
969674718 4:8608302-8608324 AAGGGAAAGTGCAGGGAGGGAGG - Intronic
969702255 4:8774048-8774070 AGGGGGCAGGGCAGTGGGGAAGG - Intergenic
970215192 4:13751661-13751683 ATGGGCAAACCCAGTGAGGACGG + Intergenic
970243396 4:14032802-14032824 CTGGGGAAAGGCAGTGAGCATGG - Intergenic
970437793 4:16052265-16052287 CTGTGGGAGTGCAGTGAGTAAGG - Intronic
970897706 4:21122696-21122718 ATGAGGAAGTGAGGTGAGAAGGG + Intronic
971055734 4:22910602-22910624 AGGAGGAAGGGCAGAGAGGAGGG + Intergenic
971385103 4:26135053-26135075 AAGGAGGAATGCAGTGAGGAAGG - Intergenic
972607422 4:40626689-40626711 ATGGGGAGAGGCAGTGGGGAGGG - Intronic
972933534 4:44104213-44104235 ATGGCACAGTACAGTGAGGAGGG + Intergenic
974375059 4:61065150-61065172 ATGGGGAGATGTAGTAAGGAAGG + Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975373287 4:73612993-73613015 ATCTGGACCTGCAGTGAGGAGGG - Intronic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
976244070 4:82990050-82990072 GTGGGCAAGGGCAGTGGGGATGG - Intronic
976829916 4:89304047-89304069 ACCTGGATGTGCAGTGAGGAAGG - Intronic
977272987 4:94940998-94941020 ATTGGGAATTTCAATGAGGAAGG + Intronic
977828108 4:101557334-101557356 CTGGGGAAGTGGGGTGAGGGTGG - Intronic
978239340 4:106497141-106497163 ATGGAAAAGTGCAGGGAGTAAGG + Intergenic
978780925 4:112553185-112553207 ATGGGGAAAAGCAATGGGGATGG - Intronic
978927037 4:114259333-114259355 ATGGGTAAGTGCAATGATGAGGG + Intergenic
980408367 4:132382441-132382463 ATAGGGAAGTGCAGAGCGAAGGG + Intergenic
980843659 4:138297934-138297956 AGGGGTTAGTGCAGTGGGGAAGG - Intergenic
981253525 4:142632429-142632451 ATTGGGGAGTGTTGTGAGGAGGG + Intronic
981731995 4:147909287-147909309 ATGAGGAAGTGCTGGGAGGCTGG - Intronic
981922027 4:150096204-150096226 TGGGGGAAGGGCAGTGAAGAAGG + Intronic
982021731 4:151211487-151211509 ATGGTTAAGTTTAGTGAGGAAGG + Intronic
982090467 4:151876017-151876039 GTGGGGGAGTGGAGTGAGGGGGG - Intergenic
982752535 4:159179257-159179279 CTTGGGAAGTGCAGTTGGGAAGG + Intronic
983319018 4:166171252-166171274 ATGGGAAAGAGCAGTGATGTGGG - Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
983758207 4:171369138-171369160 ATGGTTAAGTGTAGTGAGGAAGG + Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984479138 4:180276529-180276551 ATGACGAAGCTCAGTGAGGAAGG + Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
985372538 4:189301633-189301655 CTGGGGAAGCCCAGTGAGGGTGG - Intergenic
986234561 5:5894920-5894942 AAGGGGAAGAGTAGTCAGGAGGG + Intergenic
987223580 5:15816490-15816512 GTGGGGAGGTGAAGTGGGGAAGG + Intronic
987282592 5:16426119-16426141 ATGGGGTGGGGCAGGGAGGAAGG - Intergenic
989172568 5:38487189-38487211 ATGAGGAAATGAAGTGAGGCCGG - Intronic
990032516 5:51278782-51278804 AAGGGGAAGTTCAGTGAAGGAGG - Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990629826 5:57656019-57656041 ATGATGAAGTGTAGTAAGGAAGG + Intergenic
990881701 5:60546367-60546389 AGGGGGAAGGGCAGTGGGGTGGG - Intergenic
991074023 5:62514900-62514922 AAGGGGAAGTGCAATGATGAAGG - Intronic
992025221 5:72663233-72663255 ATGGGGCAGTGCAATGAGAAGGG - Intergenic
992131053 5:73693209-73693231 ATGTGGCAGAGCAGTGGGGAAGG - Intronic
992379570 5:76223916-76223938 ATGGGGAAGTGGTGGGGGGATGG + Intronic
992818856 5:80473362-80473384 ATGGGTAACTGAAGAGAGGAAGG - Intronic
993103962 5:83577457-83577479 ATGGGGAAGTTCAGAAGGGAGGG - Intronic
993906832 5:93632659-93632681 ATTGGTAAGTGCAGTCAGGAAGG - Intronic
1000662440 5:163952262-163952284 ATGGGGAAAAGCACTGAGGGAGG + Intergenic
1001108589 5:168876421-168876443 ATGGGGAGGTGCAGGAAGGTAGG - Intronic
1002338727 5:178500061-178500083 GTGGGGAGGTACAGGGAGGAAGG + Intronic
1002453536 5:179332734-179332756 AGGGAGGAGTGCAGAGAGGAAGG + Intronic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1003879040 6:10463813-10463835 AGGGGTAAGTGGAGTCAGGAAGG + Intergenic
1005495387 6:26383494-26383516 AGGGGGAAGTGGAGGGACGAGGG + Intronic
1005500073 6:26421792-26421814 AGGAGGAAGTGAAGGGAGGAGGG + Intergenic
1005504549 6:26458310-26458332 AGGAGGAAGTGAAGGGAGGAGGG + Intronic
1005508976 6:26495109-26495131 GAGGGGAAGTGAAGTGAAGATGG - Intergenic
1006027103 6:31154169-31154191 ATTGTGGAGGGCAGTGAGGAAGG - Intronic
1006267655 6:32938634-32938656 ACCAGGAAGTGCAGTTAGGAGGG - Intronic
1006464560 6:34184705-34184727 ATGGGGTCTTGCAGTGATGATGG - Intergenic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007371589 6:41429788-41429810 AGGGGGACGTGGAGGGAGGAAGG - Intergenic
1007730620 6:43943306-43943328 ATGGGCATGGGCAGTGTGGAAGG - Intergenic
1007920700 6:45607069-45607091 AGAGGGAAGAGCAGTGGGGAGGG + Intronic
1008520376 6:52357291-52357313 AGGGGGAAGTGAAGAGAGGTTGG + Intergenic
1008690622 6:53974721-53974743 ACTTGGAAGTGCAGTGTGGAGGG - Intronic
1008921740 6:56850117-56850139 AAGGGGAGGTGGAGGGAGGATGG - Intronic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1011734891 6:90300381-90300403 GTGGGGAAGTGCAGGGAGGCTGG + Intergenic
1012340055 6:98109751-98109773 ATGGGTAAGCTTAGTGAGGAAGG - Intergenic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1016094262 6:140016814-140016836 ATGGGGAAGTGAAATAATGAAGG + Intergenic
1016428063 6:143955472-143955494 ATGTGGAGATGCAGTGAGGAGGG + Intronic
1017315433 6:153025836-153025858 ATGAGGAAGTGCAGAGATTATGG - Intronic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1017908298 6:158771835-158771857 ATGGGGAGCAGCAGTGAGGCTGG - Intronic
1017941288 6:159055504-159055526 AAGGCGGGGTGCAGTGAGGATGG - Intergenic
1018481494 6:164195526-164195548 ATTTGAAAGTGGAGTGAGGATGG - Intergenic
1019115300 6:169755799-169755821 ATGGGGAACTGAAGGGAGTATGG + Intronic
1019502242 7:1370069-1370091 ATGTGGAGGGGCAGTGTGGATGG + Intergenic
1019627980 7:2030903-2030925 ATGAGGAAGAACAGAGAGGATGG - Intronic
1019796761 7:3055512-3055534 ATGGGGGACAGTAGTGAGGAAGG - Intergenic
1020571042 7:9861794-9861816 ATTGGGAAGGGTAGTGGGGAGGG + Intergenic
1022013622 7:26330019-26330041 ATGAGGAAGTGCGATCAGGAAGG + Intronic
1022490518 7:30813906-30813928 ATGGGGCAGTGTAGGGTGGAAGG + Intronic
1023808280 7:43890656-43890678 GTGGGGAAGTGCCCAGAGGAGGG - Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024685969 7:51745373-51745395 AATGGCAAGTGCAGTGTGGAGGG - Intergenic
1024996290 7:55275332-55275354 ATGGGGCTGTGCAGTGGGAAGGG - Intergenic
1026224246 7:68426741-68426763 ATAGGGGAGTGGAGTGAGAAGGG + Intergenic
1026238064 7:68545994-68546016 ATGGGAAAGTGGAGAGAGTAAGG - Intergenic
1026988448 7:74569456-74569478 GTGGGGTTGTGCAGTGAGGGGGG + Intronic
1027232750 7:76281989-76282011 GGGGGGTAGTTCAGTGAGGAGGG - Intronic
1028865893 7:95711043-95711065 ATGTGGTAGTGAAGTGTGGAAGG - Intergenic
1030085982 7:105816095-105816117 ATGGGGAGGAGAAGTGAGGGTGG + Intronic
1030497318 7:110315974-110315996 ATGGGGGAGGGTAGTGAGCATGG - Intergenic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1030884802 7:114923207-114923229 TGGGGGGAGTGCTGTGAGGAGGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031570241 7:123350222-123350244 GTGAGGAAGAGTAGTGAGGAGGG - Intergenic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1031928894 7:127664457-127664479 ATGGGGAGGTGCTGAGAGGGTGG + Intronic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1034260558 7:149752804-149752826 ATGGGGAAGCCCAGGGAGGCCGG + Intergenic
1035012107 7:155728355-155728377 TGGGTGAAGGGCAGTGAGGAGGG - Intronic
1035242391 7:157540717-157540739 CTGGGGAAGGGCCTTGAGGATGG + Exonic
1035463329 7:159060027-159060049 GTGGGTAAGTGAAGTGAGGATGG - Intronic
1035624295 8:1059847-1059869 ATGGGGCAGTGCAGAGAGTCGGG + Intergenic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036556537 8:9864891-9864913 ATGGAGTAGAGCAGAGAGGAAGG - Intergenic
1036727770 8:11234951-11234973 ATGTGGAGGTGCAGTGGGGAAGG + Intergenic
1037676919 8:21059108-21059130 ATAGGGAGGTGCAGTGGGGTGGG - Intergenic
1038069274 8:23995440-23995462 ATTGAGAAGTGCAGTGGGGAAGG + Intergenic
1038077386 8:24091605-24091627 CTGGTGAAGTGGAGTGAGCAAGG + Intergenic
1038141764 8:24852608-24852630 ATGGGGAATTGGAGTGAGAGGGG - Intergenic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1040033758 8:42849136-42849158 ATGATCAAGTGTAGTGAGGAAGG - Intergenic
1040991552 8:53356662-53356684 ATGAGGTAGTGGAGTGAGGGGGG + Intergenic
1041330051 8:56714457-56714479 GTGGGGAAGGACAGTGAGGGAGG - Intergenic
1041682634 8:60608617-60608639 CTGGGGAAGGCCAGTGAGGTGGG - Intronic
1042321658 8:67481906-67481928 ATGGGGAAGTGCAGGCAGCCTGG - Intronic
1043008759 8:74855678-74855700 AGGAGGAAGTGAAGTGAGCAAGG - Intergenic
1044259600 8:90102172-90102194 ATGGGTAAGCCTAGTGAGGAAGG - Intergenic
1045083999 8:98660808-98660830 ATGGGAAAGTGAAGAGAAGAGGG - Intronic
1046365527 8:113225995-113226017 AAGGAGAAGTGCAGTGGGAAGGG - Intronic
1046742072 8:117840244-117840266 CTGGGGCAGTGCAGTCAGGAAGG + Intronic
1047676823 8:127211844-127211866 TTGGGGGAGTTGAGTGAGGAGGG - Intergenic
1048317305 8:133371684-133371706 ATGAGGAAGAGCAGAAAGGAAGG + Intergenic
1048607946 8:135989694-135989716 ATGGGGCAGCACAGTGAAGATGG - Intergenic
1049052585 8:140210453-140210475 ATGGGGAAGTCCAGAGAGAGTGG - Intronic
1049155292 8:141062534-141062556 ATGGGGAAGTGGAGGGATCATGG + Intergenic
1049347759 8:142147847-142147869 GTGTGGGAGTGCAGAGAGGAAGG - Intergenic
1049356711 8:142192749-142192771 AGGGGGAGGAGCAGGGAGGAGGG + Intergenic
1049356756 8:142192896-142192918 AGGGGGAGGAGCAGGGAGGAGGG + Intergenic
1050036431 9:1440567-1440589 AGGGTGAAGTTCAGTGAGGATGG - Intergenic
1050176482 9:2874315-2874337 ATAGGCAAATGCAGTGAGGGTGG + Intergenic
1050876424 9:10643141-10643163 ATGTGGAAATGCAGTCATGAAGG + Intergenic
1051264644 9:15298912-15298934 ATGGAGAAGTGATGTGGGGAAGG - Intronic
1051794595 9:20851387-20851409 AAGTGGAAGAGCAGTGCGGAAGG + Intronic
1052793369 9:32899329-32899351 ATGGGGAAGTGGAGTGACTCAGG + Intergenic
1052899052 9:33774511-33774533 ATGAGGCAGGGCAGGGAGGAGGG + Intronic
1053289279 9:36869339-36869361 AGTGGGAGGTGGAGTGAGGAGGG - Intronic
1053542935 9:38993590-38993612 AGGGTGAAGTGCACTCAGGATGG + Intergenic
1053807378 9:41817107-41817129 AGGGTGAAGTGCACTCAGGATGG + Intergenic
1054623214 9:67370320-67370342 AGGGTGAAGTGCACTCAGGATGG - Intergenic
1055357669 9:75454174-75454196 ATGGGAAAGTGCAGGGAGCTGGG - Intergenic
1056177653 9:84051120-84051142 AGAGGGAAGTGGGGTGAGGAAGG - Intergenic
1056233977 9:84573541-84573563 ATGGGGAGGTGAAGTAGGGATGG - Intergenic
1056300132 9:85231970-85231992 ATGGGGAAGTGCAGTGCCTCAGG - Intergenic
1056591142 9:87967081-87967103 AAGGAGAAGTGCAGAGAGTAAGG - Exonic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1057342201 9:94212875-94212897 AAGGGGAGGAGCAGTCAGGATGG + Intergenic
1058123566 9:101166137-101166159 ATGTGGACGTGCAGTGATGCTGG - Intronic
1058320328 9:103622158-103622180 AAGGGGAAGTGCAGAGCGAAAGG + Intergenic
1058535666 9:105957521-105957543 ATAGGGAAGAGCAGAGAGCAAGG + Intergenic
1058897864 9:109415652-109415674 TGGGGGCAGTGCAGTGGGGATGG + Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1060640279 9:125232412-125232434 ATTGGGTAGTCCAGGGAGGAAGG - Intronic
1061226747 9:129284882-129284904 ATGGGTAACTGCAGAGAAGAGGG + Intergenic
1061360018 9:130135466-130135488 GTGGGGAAGTGTAGCAAGGACGG + Exonic
1061374485 9:130215920-130215942 ATGGGGGAGGGCAGAGAAGAGGG - Intronic
1061801329 9:133114869-133114891 TTGGGTCAGTGCAGTGAGGGTGG + Intronic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062271795 9:135713225-135713247 ATGGGGAGGTGCAGGCAGGCAGG - Intronic
1185597199 X:1314427-1314449 TTGGGCAAGTGCAGTGCGGTTGG - Intergenic
1185597320 X:1314921-1314943 TTGGGCAAGTGCAGTGCGGTTGG - Intergenic
1185821525 X:3209289-3209311 ATGGGGAAGGGCTGTGAGTAGGG - Intergenic
1187218330 X:17298758-17298780 ATGGGGAAGTGAAATAGGGAAGG - Intergenic
1187260775 X:17683392-17683414 ATGGGGTAGGGGAGTGAGAATGG - Intronic
1187843833 X:23515559-23515581 GTGGGGAAGTGAATTGGGGAAGG - Intergenic
1189197654 X:39165746-39165768 GTGGGGAGGAGCAGTGAGGAGGG - Intergenic
1189535418 X:41929990-41930012 ATGGGGAAGTGAATTGGGGTGGG - Intergenic
1189560135 X:42183829-42183851 GTGTGGAAGTGCAGAGAAGATGG + Intergenic
1189988781 X:46575489-46575511 AGGGGGAAGTGTAGGGGGGAGGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191899616 X:66027300-66027322 ATGGTCAAGGGCACTGAGGATGG - Intronic
1192197407 X:69037863-69037885 ATGGGAAAGGGCAGAGATGAAGG + Intergenic
1192228110 X:69243289-69243311 AGGGGCAATGGCAGTGAGGAGGG - Intergenic
1192326541 X:70137148-70137170 ATGGGGGAGTACATTTAGGAGGG + Intronic
1192495079 X:71611027-71611049 AAGGGGAAATGCAGAGAGAAAGG - Intronic
1194671638 X:96740921-96740943 ATGGGGAAGAGCTCTGAGGTTGG - Intronic
1195001131 X:100644534-100644556 TTGGGGTAGTGGAGTGTGGAGGG - Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196812673 X:119641128-119641150 AAGGGGAAGTGGAATGAGGGGGG + Intronic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1197744321 X:129920812-129920834 TTGGGGAAGAGCCATGAGGATGG + Intronic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198993435 X:142544312-142544334 ATGTTAAAGTGCAGTCAGGATGG + Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic