ID: 1062826858

View in Genome Browser
Species Human (GRCh38)
Location 10:576297-576319
Sequence GTGAGTGCTCGAGTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062826858_1062826859 13 Left 1062826858 10:576297-576319 CCACATCACACTCGAGCACTCAC No data
Right 1062826859 10:576333-576355 TTACTCATACGTGTGTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062826858 Original CRISPR GTGAGTGCTCGAGTGTGATG TGG (reversed) Intronic
No off target data available for this crispr