ID: 1062829066

View in Genome Browser
Species Human (GRCh38)
Location 10:593419-593441
Sequence GGGTCTGCTGGGAGACAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062829066_1062829080 20 Left 1062829066 10:593419-593441 CCCCGCTGTCTCCCAGCAGACCC No data
Right 1062829080 10:593462-593484 CCGCCCTGCTCTGCCCACGCGGG No data
1062829066_1062829078 19 Left 1062829066 10:593419-593441 CCCCGCTGTCTCCCAGCAGACCC No data
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062829066 Original CRISPR GGGTCTGCTGGGAGACAGCG GGG (reversed) Intronic
No off target data available for this crispr