ID: 1062829078

View in Genome Browser
Species Human (GRCh38)
Location 10:593461-593483
Sequence GCCGCCCTGCTCTGCCCACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062829075_1062829078 -3 Left 1062829075 10:593441-593463 CCACACCCGGGTCTGTGCATGCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829064_1062829078 25 Left 1062829064 10:593413-593435 CCTCACCCCCGCTGTCTCCCAGC 0: 1
1: 2
2: 6
3: 61
4: 572
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829077_1062829078 -9 Left 1062829077 10:593447-593469 CCGGGTCTGTGCATGCCGCCCTG 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829066_1062829078 19 Left 1062829066 10:593419-593441 CCCCGCTGTCTCCCAGCAGACCC No data
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829068_1062829078 17 Left 1062829068 10:593421-593443 CCGCTGTCTCCCAGCAGACCCCA 0: 1
1: 0
2: 5
3: 58
4: 621
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829074_1062829078 -2 Left 1062829074 10:593440-593462 CCCACACCCGGGTCTGTGCATGC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829065_1062829078 20 Left 1062829065 10:593418-593440 CCCCCGCTGTCTCCCAGCAGACC No data
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829072_1062829078 7 Left 1062829072 10:593431-593453 CCAGCAGACCCCACACCCGGGTC 0: 1
1: 0
2: 2
3: 27
4: 244
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829073_1062829078 -1 Left 1062829073 10:593439-593461 CCCCACACCCGGGTCTGTGCATG 0: 1
1: 0
2: 1
3: 16
4: 171
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829076_1062829078 -8 Left 1062829076 10:593446-593468 CCCGGGTCTGTGCATGCCGCCCT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829071_1062829078 8 Left 1062829071 10:593430-593452 CCCAGCAGACCCCACACCCGGGT 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data
1062829067_1062829078 18 Left 1062829067 10:593420-593442 CCCGCTGTCTCCCAGCAGACCCC 0: 1
1: 0
2: 7
3: 46
4: 496
Right 1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062829078 Original CRISPR GCCGCCCTGCTCTGCCCACG CGG Intronic
No off target data available for this crispr