ID: 1062834539

View in Genome Browser
Species Human (GRCh38)
Location 10:627116-627138
Sequence GGTGGTCCCCGCACACGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062834537_1062834539 -3 Left 1062834537 10:627096-627118 CCGCGTGGGGCTCAGAGATGGGT 0: 1
1: 0
2: 5
3: 35
4: 175
Right 1062834539 10:627116-627138 GGTGGTCCCCGCACACGCAGTGG No data
1062834530_1062834539 27 Left 1062834530 10:627066-627088 CCAGGATTTCGCTCGGCTATGGA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1062834539 10:627116-627138 GGTGGTCCCCGCACACGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062834539 Original CRISPR GGTGGTCCCCGCACACGCAG TGG Intronic
No off target data available for this crispr