ID: 1062834737

View in Genome Browser
Species Human (GRCh38)
Location 10:628306-628328
Sequence GGCCAATGGTCTCGTTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062834737 Original CRISPR GGCCAATGGTCTCGTTCTTC AGG (reversed) Intronic
902605567 1:17567251-17567273 GGCCACTGGCCTCTTTCTGCTGG + Intronic
904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG + Intergenic
915121763 1:153633871-153633893 GGCCAATGGTCCTGTTGTTGGGG - Intronic
920678703 1:208056756-208056778 GGCCATAGGTCTCTTTCCTCGGG + Intronic
1062834737 10:628306-628328 GGCCAATGGTCTCGTTCTTCAGG - Intronic
1066121784 10:32296231-32296253 GGCCAATGTTCTGCTTCTTAAGG + Intronic
1077899324 11:6476812-6476834 GGCCAATGGCATCACTCTTCAGG - Exonic
1081061154 11:38479514-38479536 GGACAATGTTCTCATTCTCCTGG - Intergenic
1086588044 11:88478852-88478874 GGGCAATGATCTCGTTCATGAGG - Intergenic
1087023188 11:93623724-93623746 GGGAAATGGTGTCGTCCTTCAGG - Intergenic
1087781089 11:102302230-102302252 GGCCAATTGCCTCTTTCTTTTGG - Intergenic
1091003122 11:131927533-131927555 GGCCTATGGTCACCTTCCTCTGG + Intronic
1091802368 12:3332733-3332755 GGCCAATGGCCGCCTTCTTGCGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1095523495 12:43096348-43096370 GGGCAATGGTCCCGTTGTCCTGG + Intergenic
1096622408 12:52872912-52872934 GCACAATGGTCTGGTTCTCCAGG - Intergenic
1102493037 12:113300288-113300310 GGCCAGTGGTCTCGAACTCCTGG - Intronic
1106430668 13:29677412-29677434 GGCTAATGTTCTCATTTTTCTGG + Intergenic
1108303734 13:49108800-49108822 GCCCTTTGGTCTCGTTTTTCAGG + Intronic
1108436445 13:50405853-50405875 GGCAAGTGTTCTCATTCTTCAGG + Intronic
1108533300 13:51347176-51347198 TGCCTATGGCCTCGTCCTTCAGG + Exonic
1119167697 14:72508991-72509013 GGGCATTGGTCTAATTCTTCTGG - Intronic
1120382914 14:83805411-83805433 GGACAATGGTATCTTTCATCAGG - Intergenic
1127315898 15:57793334-57793356 GCCCAATGGTCTCATTTTCCAGG - Intergenic
1129790505 15:78337900-78337922 GGACAGTGGTGTCGTTCTGCAGG - Intergenic
1132762847 16:1519412-1519434 AGCCGATGGTCTCGGTTTTCAGG - Intronic
1140834405 16:78780083-78780105 GGCCATGGTTCTCGTACTTCAGG + Intronic
1140846958 16:78899581-78899603 GGCCAATGTTCCCGTTGTTCAGG - Intronic
1151631759 17:75315798-75315820 GGCGCATGGCCTCGCTCTTCAGG - Intergenic
1158455842 18:57606751-57606773 GAGCTATTGTCTCGTTCTTCAGG - Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
946334921 2:219030115-219030137 GGCCCATGGCATCGTGCTTCCGG - Exonic
948085580 2:235244081-235244103 GACAAATCGTCTCGTTTTTCAGG - Intergenic
1174724069 20:52842949-52842971 GGCCGTTGTTCTCGTTCTTTTGG + Intergenic
1183257783 22:36773795-36773817 GGCAAATGTTCTCATTTTTCTGG + Intronic
952492419 3:33885372-33885394 GACCAGTGGTCTCATGCTTCTGG + Intergenic
953011178 3:39026902-39026924 AGCCCATGGTCTGGGTCTTCAGG + Intergenic
961697367 3:128714779-128714801 GGCCACTGGTCTCTTTCATGAGG - Intergenic
965424825 3:168509077-168509099 GGCCGCTGCTCTGGTTCTTCTGG + Intergenic
971253021 4:24988980-24989002 GGTTAATGGCCTCTTTCTTCTGG - Intergenic
975888046 4:78989229-78989251 TGACAATGGTCTCTTTCTTTTGG + Intergenic
982859051 4:160425632-160425654 GGCCAATGGTTTTGATATTCTGG + Intergenic
983490635 4:168385235-168385257 GGCTAATGGTTTAATTCTTCAGG + Intronic
984811823 4:183802011-183802033 GACTAATGGTGTCTTTCTTCGGG - Intergenic
994310099 5:98259498-98259520 GGCCCAAGGTCTCTTTCTTCAGG + Intergenic
998734328 5:145118239-145118261 GGCCAGTGGTCTCTTTCATGTGG + Intergenic
1016613817 6:146024529-146024551 GGCCTATGGCCTCTTTGTTCTGG + Intergenic
1017560710 6:155625322-155625344 GGGCAATGGTATCTTTCTTTTGG + Intergenic
1022483992 7:30763771-30763793 GGGCAGTGGTCTCTTTCTCCAGG - Intronic
1022525549 7:31034829-31034851 GGCCAATGAGCTTGTTCTCCGGG - Intergenic
1030711683 7:112757466-112757488 GGCCAATGCTGTGGTCCTTCTGG - Intergenic
1037648463 8:20815346-20815368 GCCCAATGGTCCCCTTCTCCTGG + Intergenic
1038614151 8:29077184-29077206 GGCTGAAGGTCTTGTTCTTCAGG - Intronic
1038923664 8:32113919-32113941 GGCCAATGGTCTAAGACTTCTGG + Intronic
1042123057 8:65508597-65508619 GGCAGATGGTCTGGTTCTTTAGG - Intergenic
1042898414 8:73695720-73695742 GGTCCATGGGCTCATTCTTCAGG - Intronic
1044965736 8:97571901-97571923 GCCCAGTGGTCTCGAACTTCTGG - Intergenic
1046751156 8:117928146-117928168 GGCCAATGGACTCATTTTGCAGG + Intronic
1055278136 9:74642574-74642596 TGCCGCTGGTCTCGTTGTTCAGG - Exonic
1058217279 9:102250465-102250487 CCCCAATGGTCTCTTTCTACAGG + Intergenic
1058703938 9:107623613-107623635 GTAGAATGGTCTAGTTCTTCAGG - Intergenic
1192317183 X:70062233-70062255 GTCCAATGGGCTCATACTTCCGG + Intergenic
1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG + Intronic
1200397510 X:155999796-155999818 GGGGAAGGGTCTGGTTCTTCTGG - Intronic
1202049605 Y:20766862-20766884 GGCCAATGCTCTGGTGCTTATGG + Intronic