ID: 1062838721

View in Genome Browser
Species Human (GRCh38)
Location 10:652977-652999
Sequence CCCACGTCCCCAAAGACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062838715_1062838721 8 Left 1062838715 10:652946-652968 CCCTCGCAAGACTGTGGGCATCT 0: 1
1: 0
2: 4
3: 9
4: 89
Right 1062838721 10:652977-652999 CCCACGTCCCCAAAGACCAAGGG No data
1062838716_1062838721 7 Left 1062838716 10:652947-652969 CCTCGCAAGACTGTGGGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 104
Right 1062838721 10:652977-652999 CCCACGTCCCCAAAGACCAAGGG No data
1062838711_1062838721 27 Left 1062838711 10:652927-652949 CCACACACTGAGCCATAAACCCT 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1062838721 10:652977-652999 CCCACGTCCCCAAAGACCAAGGG No data
1062838712_1062838721 15 Left 1062838712 10:652939-652961 CCATAAACCCTCGCAAGACTGTG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1062838721 10:652977-652999 CCCACGTCCCCAAAGACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062838721 Original CRISPR CCCACGTCCCCAAAGACCAA GGG Intronic
No off target data available for this crispr