ID: 1062841153

View in Genome Browser
Species Human (GRCh38)
Location 10:673036-673058
Sequence CCTTGGTTCTAACCAGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062841153_1062841168 22 Left 1062841153 10:673036-673058 CCTGTACCTGGTTAGAACCAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1062841168 10:673081-673103 GCCTTGCTGCTCAGCTGGGAGGG No data
1062841153_1062841163 17 Left 1062841153 10:673036-673058 CCTGTACCTGGTTAGAACCAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1062841163 10:673076-673098 CCCCGGCCTTGCTGCTCAGCTGG No data
1062841153_1062841170 23 Left 1062841153 10:673036-673058 CCTGTACCTGGTTAGAACCAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1062841170 10:673082-673104 CCTTGCTGCTCAGCTGGGAGGGG No data
1062841153_1062841165 18 Left 1062841153 10:673036-673058 CCTGTACCTGGTTAGAACCAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1062841165 10:673077-673099 CCCGGCCTTGCTGCTCAGCTGGG No data
1062841153_1062841167 21 Left 1062841153 10:673036-673058 CCTGTACCTGGTTAGAACCAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1062841167 10:673080-673102 GGCCTTGCTGCTCAGCTGGGAGG No data
1062841153_1062841161 0 Left 1062841153 10:673036-673058 CCTGTACCTGGTTAGAACCAAGG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1062841161 10:673059-673081 GGGATGGAATGAGCTTTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062841153 Original CRISPR CCTTGGTTCTAACCAGGTAC AGG (reversed) Intronic
901878641 1:12181259-12181281 CCTTGGTTTTAGCCAAGAACTGG - Intronic
906076567 1:43056295-43056317 CCTTGGATATAGCCAGGTAGGGG + Intergenic
913498755 1:119451520-119451542 CCTTCTTCCTAATCAGGTACTGG + Intergenic
1062841153 10:673036-673058 CCTTGGTTCTAACCAGGTACAGG - Intronic
1067704173 10:48594757-48594779 CCTTATTTCTAGCTAGGTACAGG + Intronic
1070565588 10:77601716-77601738 CCTTGGTGCTTACCAGGGCCCGG - Intronic
1074926282 10:118075464-118075486 CCCAGGTTCTAACCAGAAACTGG - Intergenic
1075220490 10:120580454-120580476 TCTTGGTTTTAACCAGTTTCAGG + Intronic
1077177746 11:1198296-1198318 CCGTGGCTCTTACCTGGTACAGG - Intronic
1079240789 11:18721056-18721078 CCTTAGGTCTAACCAGCTTCTGG - Intronic
1084497999 11:69516550-69516572 CCTGGCTTCTAACCAGGTGGAGG + Intergenic
1086983576 11:93224987-93225009 CCTTGGTTCTAAGCAGAGAAAGG - Intergenic
1089762110 11:120735532-120735554 CATAGGTGGTAACCAGGTACTGG - Intronic
1092299855 12:7237052-7237074 ACTTTGTACTAACCAGGCACTGG + Intergenic
1106206361 13:27599560-27599582 CTTATGTTCTAACCAGGTAAAGG + Intronic
1111174877 13:84581206-84581228 CCTAGGTTCTGATGAGGTACGGG - Intergenic
1111795198 13:92910540-92910562 CCTTGGTTCTTACCTGGACCTGG - Intergenic
1124247486 15:28083514-28083536 ACTTTGTTCTTACCAGGTAGTGG - Intronic
1125657084 15:41366937-41366959 CCTTGGTTCTAAGTGGGTACAGG + Intronic
1126972421 15:54131679-54131701 CCTTGGTTCTAGTCATGCACTGG + Intronic
1134069846 16:11254348-11254370 ACTTGGTTCTGAACAGGTCCAGG - Intronic
1135165498 16:20135391-20135413 CCTTGGTTCCAACCCAGTAGGGG + Intergenic
1139492869 16:67296049-67296071 CCTTTGTTCTAAGCAAGTGCTGG + Intronic
1140946096 16:79769815-79769837 TCTTGGTTCTATCCACTTACTGG - Intergenic
1142231809 16:88903591-88903613 CTTTGGTTGTCACCAGGGACTGG - Intronic
1142475822 17:188928-188950 CCGTGGTTCTAACCAGTTTGGGG - Intergenic
1144891459 17:18496560-18496582 CCTTGGTTCTGACCAGGAGAAGG + Intergenic
1145140762 17:20447757-20447779 CCTTGGTTCTGACCAGGAGAAGG - Intergenic
1145795099 17:27650910-27650932 CCTTGGTTCTGACCAGGAGAAGG + Intergenic
1148153402 17:45409704-45409726 GCTGGGTTCTAACCAGCTCCTGG + Intronic
1149387291 17:56154737-56154759 CCCTGATTCTAACCAGTTAGGGG + Intronic
1152061290 17:78077579-78077601 CCTTGGTGCTAACTTGGGACTGG + Intronic
1152279511 17:79376962-79376984 CCTTGGTCCTCAGGAGGTACTGG - Intronic
1203162099 17_GL000205v2_random:62537-62559 CCTGGGTTCGAACCAGGGTCCGG + Intergenic
1155912187 18:31516731-31516753 CTTTAGTTCTGACCATGTACTGG - Intronic
1156864896 18:41877840-41877862 CCTTGGTTCTAAAGATGTATGGG - Intergenic
1157491881 18:48129286-48129308 CATTGGTTCTAACCAGGAGATGG - Intronic
1160873487 19:1287094-1287116 CCTTGTTTTGAACCAGGTCCGGG + Intronic
1161620488 19:5294440-5294462 CCTTGGGTTTATCTAGGTACAGG + Intronic
1167035943 19:46995015-46995037 CCCTGGTTGGAACCAGGCACAGG - Intronic
925745900 2:7043236-7043258 CCTGTGTTCTAATCAGGAACTGG - Exonic
926585505 2:14681306-14681328 CCTTGGTCCTAAGTAGCTACTGG + Intergenic
930874480 2:56199113-56199135 CCTTTGTTCTAACCAATTTCAGG - Intronic
933030661 2:77324878-77324900 CCTTGGTTCGAATCACCTACAGG - Intronic
933720022 2:85391810-85391832 GCCTGGCTCTAACCAGGTTCCGG - Intergenic
935673338 2:105573751-105573773 ACTTGGTTATATCCAGGCACAGG - Intergenic
937333616 2:121047181-121047203 CATTGTTTCTCTCCAGGTACAGG + Intergenic
948064304 2:235065225-235065247 TGTTGGTTCTAACCAGGCTCGGG - Intergenic
1168902160 20:1374196-1374218 TCTTGGCTCTAACCAGGTAAAGG - Intronic
949575008 3:5330715-5330737 CCTTGGCTCTGACCAGGTAGAGG - Intergenic
956197542 3:66668198-66668220 GCTTGGTTCTAATCAGGATCAGG + Intergenic
965780379 3:172279398-172279420 CCTAGGTTCCAAACAGGTTCTGG - Intronic
968392621 4:205523-205545 CCTTGGTTCCAAGCAGCTCCTGG - Intergenic
970365440 4:15353653-15353675 CCTGGGTCCTAACCAGGGAGCGG + Intronic
971244604 4:24916925-24916947 TCTTGGTTTTAACCAGGATCAGG + Intronic
972404206 4:38731132-38731154 CCTTGGTTATGTCCATGTACCGG + Intergenic
983380391 4:166984282-166984304 CCTTGGTTCTCACTAGATTCTGG - Intronic
987135054 5:14892620-14892642 CCTTGGTCCTAAGCTGGCACTGG - Intergenic
987463736 5:18247426-18247448 TCTTGGTTTTATCCAGGTTCAGG + Intergenic
988826282 5:34938706-34938728 CCTTGGTTTTAACTAAGCACAGG + Intronic
992030372 5:72715077-72715099 CCTTGGTTCTAACAGGCTAGTGG + Intergenic
995847399 5:116508869-116508891 CCTTTATACTACCCAGGTACAGG + Intronic
1000480185 5:161763670-161763692 CCTTGGTTCTTCCCATCTACTGG - Intergenic
1003254715 6:4464864-4464886 CAGTGGTTCTAACCAGACACAGG - Intergenic
1008467583 6:51847822-51847844 CCTTGGTTCTGACCTGGTGATGG + Exonic
1022414806 7:30168692-30168714 CCTTGCTTGTAACCAATTACAGG - Intergenic
1022864838 7:34406685-34406707 CCTTGGTTCTAATGGGGTACTGG + Intergenic
1024405510 7:48975005-48975027 ACTTTGTACTAACCAGGCACTGG - Intergenic
1026130780 7:67619199-67619221 CCTGGATTCTAACGAGGTTCGGG - Intergenic
1027126858 7:75562827-75562849 CATTGACTCTAACCAGGTTCAGG - Intronic
1032353341 7:131186211-131186233 CCTCTGTTCTGACCAGGTATGGG + Intronic
1033390391 7:140922655-140922677 CCTTTGTCTTAACCAGGCACAGG - Intronic
1035315217 7:157993390-157993412 TCCTGGCTCTGACCAGGTACGGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1040491220 8:47924220-47924242 CCTTGGTTCCAACCTGGGGCCGG - Intronic
1041322451 8:56627588-56627610 CCTTGTTTGTAACAAGGGACTGG - Intergenic
1043722279 8:83559731-83559753 CCTTTGTTCTTTTCAGGTACTGG - Intergenic
1043839149 8:85081661-85081683 CCTTGCTCCTATCCAGGTAGAGG + Intergenic
1044151747 8:88786335-88786357 CCATAGTTCTAAGCAGGTAATGG - Intergenic
1051142125 9:13988789-13988811 ATTTGGTTCTCCCCAGGTACAGG + Intergenic
1054952845 9:70872440-70872462 GGATGGTTCTATCCAGGTACAGG - Intronic
1055392826 9:75841587-75841609 CCTAGGATCTAACCAGGCACCGG - Intergenic
1059348078 9:113645813-113645835 CCTTGTTACAAGCCAGGTACCGG + Intergenic
1059485942 9:114626883-114626905 CCTGGGTTCCAAGCAGGTCCCGG + Exonic
1061022582 9:128025848-128025870 CCTAGGTTCTCACCAGGCACTGG + Intergenic
1061338851 9:129962487-129962509 CCTAGGTTCTGACGAGGTACGGG - Intronic
1062597017 9:137304074-137304096 CCTTGGTGCTCAACAGGCACAGG + Intergenic
1191834127 X:65445972-65445994 CCTTGGGTGAAACCTGGTACTGG - Intronic
1200218762 X:154380388-154380410 CCTAGGTTGTACCCAAGTACAGG - Intronic