ID: 1062842800

View in Genome Browser
Species Human (GRCh38)
Location 10:684195-684217
Sequence GTGGCAGCACTGATATGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062842800 Original CRISPR GTGGCAGCACTGATATGTGT GGG (reversed) Intronic
901952650 1:12760939-12760961 GTGGCAGCTCTCAGAAGTGTGGG - Exonic
907114736 1:51958808-51958830 GGGGCAGAACTGATAGGGGTGGG + Intronic
909325343 1:74344573-74344595 TTGGCAGAACTGATATGTACTGG + Intronic
921125076 1:212170387-212170409 GTGGCAGTACTGAGAGGTTTGGG + Intergenic
922352419 1:224745129-224745151 GTGGCAGAAATGCTATGTGACGG + Intergenic
923116586 1:230945933-230945955 GAGGCTGCACTGAAATCTGTTGG + Intronic
1062842112 10:679681-679703 TGGGGAGCACAGATATGTGTGGG - Intronic
1062842800 10:684195-684217 GTGGCAGCACTGATATGTGTGGG - Intronic
1065479525 10:26178170-26178192 GTGGCAGCACTGGTGAGTGTGGG + Intronic
1066669042 10:37817509-37817531 GTGGGAGTACTGAGATGTGTGGG - Intronic
1067673404 10:48346969-48346991 CTGGCTGCACTGTTATTTGTTGG - Intronic
1071666628 10:87564570-87564592 GTGGCAGCAATGGTAGCTGTGGG - Intergenic
1084998831 11:73010849-73010871 GTGGCAGCAGTGAGCTGGGTGGG + Intronic
1089264970 11:117252340-117252362 GGGGCAGCACTGATCAATGTGGG + Intronic
1090640466 11:128725324-128725346 GTGGATGCACTGACATGTGCAGG - Intronic
1090974795 11:131671812-131671834 GTGGAGGCAATGATATTTGTTGG + Intronic
1091150322 11:133322647-133322669 GTGGTAGCATTTATATGTCTTGG - Intronic
1093496171 12:19760827-19760849 GAGGCAGCATCCATATGTGTGGG - Intergenic
1094680290 12:32661382-32661404 GTGGCAGCTCTGAGCAGTGTTGG - Intergenic
1094797853 12:33997276-33997298 GTGGCAGCACTGGTATGGCCTGG - Intergenic
1097727252 12:63089121-63089143 GTAGCAGCACTGATGTCTTTTGG + Intergenic
1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG + Intronic
1099867029 12:88295670-88295692 GTGAGAGCTCTGATTTGTGTAGG + Intergenic
1100783327 12:98052645-98052667 GTGTAAGCCCAGATATGTGTGGG - Intergenic
1103284806 12:119791674-119791696 GAGACAGCACTGCTGTGTGTGGG - Intronic
1104272158 12:127292483-127292505 GTGGCTGCTCTGATGTGTATGGG + Intergenic
1104588756 12:130067882-130067904 GTGGCAGAAGTGATAGGTGGGGG - Intergenic
1106322163 13:28651187-28651209 GTATATGCACTGATATGTGTTGG + Intergenic
1107631735 13:42349999-42350021 TTGGTAGCACTGATAGGGGTTGG - Intergenic
1122210252 14:100168682-100168704 GTGGCGGCAGGGGTATGTGTTGG - Intergenic
1122351488 14:101096154-101096176 GCTGAACCACTGATATGTGTTGG + Intergenic
1122816590 14:104317002-104317024 GGGGCAGCCATGAGATGTGTGGG + Intergenic
1123183482 14:106491525-106491547 CTGGCTGCACTGATATTTATTGG + Intergenic
1124345832 15:28920803-28920825 ATGGCAGCACTGAGATATGGGGG - Intronic
1124639577 15:31388819-31388841 GTGGTAGAACTGGTGTGTGTGGG - Intronic
1126035727 15:44543877-44543899 GAGGGAGCAGTGATATGGGTGGG + Intronic
1131330432 15:91493860-91493882 GTGGCAACACTGTTATTTGAAGG + Intergenic
1136093645 16:27938190-27938212 TTGGCACCACTAATATGGGTGGG + Intronic
1136902654 16:34056003-34056025 GTAGCAGACCTGAAATGTGTTGG + Intergenic
1139461852 16:67128867-67128889 GTCGAAGCACCTATATGTGTTGG + Intronic
1141392519 16:83676611-83676633 GTGGCTGCACAGTGATGTGTCGG - Intronic
1143389639 17:6552646-6552668 GTGGGAGGACTGCTATGGGTAGG - Intronic
1146225907 17:31066072-31066094 GGGGCTGAACTTATATGTGTTGG + Intergenic
1146580794 17:34036859-34036881 GTGGGAATACTGAGATGTGTGGG - Intronic
1147024730 17:37571075-37571097 ATGTCAGAACTGATATGTGTTGG - Intronic
1147240241 17:39086092-39086114 GTGGAAGCAGTGAAATGTTTTGG - Intronic
1149157972 17:53656113-53656135 GTGGCATCTCTGATATCTTTTGG + Intergenic
1150032360 17:61752974-61752996 GTGGCAGCATTGAGAGGTGGGGG + Intronic
1150122191 17:62613313-62613335 GTGGGAGTACTGAGATGTGTGGG + Exonic
1151498930 17:74476462-74476484 GTGGCAGCGCTGAGTTCTGTGGG + Intronic
1157269143 18:46257226-46257248 GTGGCTGCCCTGACTTGTGTGGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1163515273 19:17759096-17759118 ATGGCTTCACTGATGTGTGTTGG + Intronic
926326117 2:11786071-11786093 GTGGCAGCACTGACAAGGCTGGG + Intronic
928272086 2:29865557-29865579 GGGGCAGGACTGAGTTGTGTTGG - Intronic
931894564 2:66714492-66714514 CTGGCAGCTCTGAAATCTGTAGG - Intergenic
938407846 2:131042508-131042530 GTGGCAGCACCCATGTGGGTAGG - Intronic
941303309 2:163830061-163830083 ATGGAAGCACTGATATGGTTTGG - Intergenic
944591370 2:201220818-201220840 TTGGCAGAACTGACATGTGAAGG + Exonic
946518985 2:220446089-220446111 GTGGCATGACTGATATGGTTTGG + Intergenic
1170597142 20:17814544-17814566 CTGGCAGTCCTGATATGTCTTGG - Intergenic
1173003698 20:39123788-39123810 GTGGCAGCAAAGACATCTGTAGG + Intergenic
1173393169 20:42653211-42653233 GTGGCAGCAAGGAGAAGTGTAGG - Intronic
1175954009 20:62599001-62599023 GTGGCTGCACTCAGCTGTGTTGG + Intergenic
1177608073 21:23408017-23408039 GTGGCAGCACTGAAGTCTTTGGG + Intergenic
1177633793 21:23759900-23759922 GTGTCAGAACTGGTTTGTGTTGG - Intergenic
1177841215 21:26236004-26236026 AGGACAGCATTGATATGTGTGGG + Intergenic
1178828024 21:36032470-36032492 TGGGGAGCACTGATGTGTGTGGG + Intergenic
1178828050 21:36032568-36032590 TGGGGGGCACTGATATGTGTGGG + Intergenic
1180621214 22:17163604-17163626 GCCCCAGCACTGATATCTGTGGG + Intronic
1181942102 22:26485970-26485992 GGGGCAGCCCTGAGATGGGTGGG + Intronic
1182752265 22:32651264-32651286 ATGCCAGCATTGATGTGTGTGGG + Intronic
1184455613 22:44608086-44608108 GTGGTTCCCCTGATATGTGTGGG - Intergenic
1184769525 22:46589300-46589322 GGGGCAGCTCTGATATGTGGGGG + Intronic
1184769537 22:46589336-46589358 GGGGCAGCTCTGATATGTGGGGG + Intronic
951814637 3:26740327-26740349 GTAGCAGCAGTGATATTTCTAGG + Intergenic
952243688 3:31562268-31562290 GTGGCTGCAATGAGTTGTGTGGG + Intronic
953302598 3:41793850-41793872 GTGGCAGCATTGGTAGGTATTGG - Intronic
953442245 3:42928343-42928365 GTGGCTGCAGTGAAATGTGTGGG + Intronic
955137951 3:56238529-56238551 GTGGCAGCACTGATCTGCTGGGG - Intronic
960136998 3:114115633-114115655 GTGCCAGCACTGATAGGAGCTGG - Intergenic
961355922 3:126339997-126340019 AGGGCATCACTGATAAGTGTGGG - Intergenic
966179589 3:177176101-177176123 TTTGCAGCACTGATATCTGGGGG + Intronic
977234083 4:94486060-94486082 GTGGCAGAACTTAGATGTATAGG - Intronic
977386353 4:96344651-96344673 TTGGCAGCTATGATATGTGATGG - Intergenic
977537616 4:98273661-98273683 TTGGCAGTACTTATTTGTGTGGG - Intronic
979103327 4:116651147-116651169 GTGGCAGCTCTGATATCTTGGGG + Intergenic
983005055 4:162474605-162474627 TTTTCAGCACTTATATGTGTAGG + Intergenic
986781620 5:11071667-11071689 GTGGCAGCAGTGATGTGGGAGGG + Intronic
988766549 5:34383897-34383919 CTGACACCACTGCTATGTGTTGG + Intergenic
994236193 5:97365747-97365769 GTGGTAGCAGTGAGAAGTGTGGG + Intergenic
998195198 5:140063011-140063033 GAGAAAGCACTGATATTTGTAGG - Intergenic
1001311736 5:170615975-170615997 GAGGCAGGACTGAGATGTTTGGG + Intronic
1002060959 5:176625789-176625811 GAGGCAGCCTTGAGATGTGTGGG - Intronic
1011984704 6:93428779-93428801 GTGGCAGCAATGATAGCTGAGGG - Intergenic
1013614252 6:111827027-111827049 GTGGAAGCACTGAGATGAGCTGG - Intronic
1017681448 6:156868271-156868293 TTGTCATCACTGATATATGTGGG + Intronic
1018739878 6:166719951-166719973 GTGGCAGCTTTGAGATATGTGGG + Intronic
1022344600 7:29502147-29502169 GTGACAGCACTGAGATGTACAGG - Intronic
1032407670 7:131668419-131668441 GTGGCTGCACTGACATGGGCTGG - Intergenic
1034221984 7:149453930-149453952 TGGGCCGCACTGATGTGTGTGGG + Intronic
1034463073 7:151209274-151209296 GGTCCAGCACTGATATGGGTTGG - Intronic
1038397134 8:27254919-27254941 GTGGGAGCACTCGTGTGTGTAGG + Intronic
1038997619 8:32942919-32942941 GTGGTATCACTTATATGTCTTGG + Intergenic
1042220028 8:66464241-66464263 ATGGCAGAGCTGATATGTATAGG + Intronic
1045712427 8:105000542-105000564 GTGGCAGTACTCATATGTATTGG + Intronic
1048104844 8:131396692-131396714 GTGGCATCATTGATCTGTGAAGG + Intergenic
1048499220 8:134960590-134960612 CTAGCAGCACTGATATGCGCAGG - Intergenic
1049516198 8:143058295-143058317 CTGGCTGCACTGATATTTATTGG + Intronic
1052386590 9:27830305-27830327 GTGGCAGGCCTGATATGGTTTGG + Intergenic
1055847708 9:80587192-80587214 TTGCCAGCACTGATATATCTTGG + Intergenic
1057733247 9:97630358-97630380 GTGGCACCTCTGCTATGTGCCGG + Intronic
1058854434 9:109046708-109046730 TTGGTATCACTGATATTTGTAGG + Intronic
1060261755 9:122081425-122081447 GTGACAGAACTAATATGTGGTGG + Intronic
1061375003 9:130219078-130219100 GTGGCTGCACGGATAGCTGTTGG + Intronic
1062045178 9:134421753-134421775 GGGGCAGCTCTGAGAAGTGTGGG - Exonic
1186196488 X:7114519-7114541 GTGGCAGTATTGAGAGGTGTGGG - Intronic
1186709908 X:12182756-12182778 TTGGCTGAACTGATTTGTGTAGG - Intronic
1188330474 X:28864950-28864972 GTGGCAGCAGTGACAAGGGTGGG + Intronic
1196411456 X:115424408-115424430 ATGGCAGCACTGACATCTTTGGG + Intergenic
1199134658 X:144235807-144235829 GTGGCAGCAGTGGGATGTGCAGG + Intergenic
1201569172 Y:15396037-15396059 GTGGCAGTATTGAGAGGTGTGGG - Intergenic
1202335724 Y:23808901-23808923 GTGGATGTACTAATATGTGTAGG + Intergenic
1202535043 Y:25861166-25861188 GTGGATGTACTAATATGTGTAGG - Intergenic