ID: 1062843081

View in Genome Browser
Species Human (GRCh38)
Location 10:686307-686329
Sequence GAGAGGCCCCGCAGGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062843081_1062843086 4 Left 1062843081 10:686307-686329 CCTCTCCACCTGCGGGGCCTCTC 0: 1
1: 1
2: 2
3: 29
4: 301
Right 1062843086 10:686334-686356 AGCACAGCCTTCCCCCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062843081 Original CRISPR GAGAGGCCCCGCAGGTGGAG AGG (reversed) Intronic
900379399 1:2376408-2376430 CAGAGGCCGAGCAGGTGGAAGGG - Intronic
900578818 1:3397600-3397622 GGGAGGCCCCGCAAGTGAACAGG + Intronic
900641707 1:3690762-3690784 GAGAGGCTCCGCAGCTAGTGAGG - Intronic
900763090 1:4486141-4486163 GAGAGGCCTCGAGGGTGGAAAGG - Intergenic
901825677 1:11859355-11859377 GAGAGGCGCCGCGGGTGGCGGGG - Intergenic
902118625 1:14142730-14142752 GAGAGGCCCTCCAGCTGCAGCGG - Intergenic
902535509 1:17117621-17117643 GAGAGGCCCAGCTGGGGTAGGGG - Intronic
902931468 1:19734593-19734615 AAGAGGCCCCCCAGGTGGGTTGG - Intronic
903373370 1:22850910-22850932 AAGAGGCCAGGCGGGTGGAGGGG + Intronic
904253121 1:29238368-29238390 GAGCAGCCCCGCCGGTGGCGAGG - Intronic
905145412 1:35883741-35883763 GAGAGGCCCGGCAGGTGGCAGGG + Intronic
905896199 1:41547459-41547481 AAATGGCCCTGCAGGTGGAGGGG + Intronic
906052606 1:42887521-42887543 TAGGGGCCCCCCAGGTTGAGGGG + Intergenic
906116265 1:43359193-43359215 GGGAGCGCCCGCAGGGGGAGGGG - Exonic
907239229 1:53071421-53071443 GAGGTGCCCAGCAGGTGGACTGG + Intronic
907308676 1:53527409-53527431 GTGAGGCCCCGCACATGGACTGG - Intronic
908330268 1:63064142-63064164 GTAAGGCCCTGCAGCTGGAGAGG + Intergenic
908796298 1:67833571-67833593 TTGTGGCCCCGCAGGAGGAGGGG + Intergenic
913163932 1:116168315-116168337 GAGAGGGCGCGCAGGAGCAGCGG + Intergenic
914504976 1:148281091-148281113 GAGAGGCCCCACAGAAGCAGAGG + Intergenic
914507588 1:148303057-148303079 GAGAGGCCCCACAGAAGCAGAGG - Intergenic
914834907 1:151198859-151198881 GGGAGGCCCCGGAGGGGGCGGGG + Exonic
915323154 1:155067077-155067099 GAGAGGCCTGGAAGGAGGAGGGG + Intronic
917848904 1:179043318-179043340 GAGAGGCCAGGCAGCAGGAGTGG + Intronic
920194038 1:204214135-204214157 GGCAGGCGCGGCAGGTGGAGGGG - Intergenic
922717043 1:227883214-227883236 GAGCGTCCCCGCAGGTGGGCAGG - Intergenic
1062843081 10:686307-686329 GAGAGGCCCCGCAGGTGGAGAGG - Intronic
1062961646 10:1576992-1577014 GGGAGGCTCAGCAGGTGCAGTGG + Intronic
1062961824 10:1578062-1578084 AAGAAGCCCCGCAGATGGGGTGG - Intronic
1065498184 10:26351228-26351250 GAGAGCCTCCTCAGGGGGAGGGG + Intergenic
1066612965 10:37268839-37268861 GAGATTGCCTGCAGGTGGAGGGG - Intronic
1069406248 10:68102413-68102435 GAGAAGCACAGCAGGTGAAGTGG - Intergenic
1071503851 10:86221517-86221539 TGGAGGTCCAGCAGGTGGAGTGG + Intronic
1072564684 10:96607720-96607742 GAGAGGCCCCGGAGGATGAGAGG + Intronic
1073055146 10:100695231-100695253 GAAAGGCCCTGCAGGGTGAGAGG + Intergenic
1074088743 10:110227373-110227395 GAGAGGTCGCGCAGGTGCTGGGG + Intronic
1074928898 10:118103386-118103408 GAGAAGACCCTCAGGTAGAGAGG - Intergenic
1075074958 10:119344613-119344635 AAAAGGCCCTGCAGGGGGAGGGG - Intronic
1075082510 10:119393317-119393339 CAGAGGCCCCGCCGGTGGATGGG - Intronic
1075387589 10:122067923-122067945 TAGAGTCCCCACAGGAGGAGGGG - Intronic
1075597609 10:123743602-123743624 GAGCAGCCCCGCAGGAGGAGTGG + Intronic
1076215847 10:128692947-128692969 GAGTTGCCAAGCAGGTGGAGAGG + Intergenic
1076434769 10:130432538-130432560 GAGAGGATTTGCAGGTGGAGAGG + Intergenic
1076494901 10:130890719-130890741 GAGAGTGGCAGCAGGTGGAGCGG + Intergenic
1076595107 10:131620395-131620417 GAGGGGCCCTGCAGCTGCAGAGG + Intergenic
1076887195 10:133268250-133268272 GACAGGCCCAGGAGGTGGGGCGG + Intronic
1076888639 10:133273718-133273740 CAGGGCTCCCGCAGGTGGAGAGG - Intronic
1077308823 11:1879608-1879630 GGGAGCACCCGCAGGTGGGGTGG + Intronic
1077366338 11:2162802-2162824 CTGAGGCCCGGCAGCTGGAGAGG + Intergenic
1077380895 11:2236885-2236907 GAGAGGCCCCTGAGGTGGGGCGG - Intergenic
1077401097 11:2357859-2357881 GAGAGGCCCCTCAGGTGGGGCGG - Intergenic
1077546186 11:3171029-3171051 TGCAGACCCCGCAGGTGGAGGGG + Intergenic
1077571188 11:3339700-3339722 CAGAGGACACGGAGGTGGAGGGG + Intronic
1077694616 11:4383235-4383257 GTGAGGGACCGCAGGTGGGGAGG - Intergenic
1078288525 11:9983064-9983086 GAGAAGCCCCGGGGGTGGTGGGG + Intronic
1078795402 11:14587228-14587250 GAGAGGCACCACAGGAGGACTGG + Intronic
1081651973 11:44830190-44830212 GAGGGGCCAGCCAGGTGGAGAGG - Intronic
1081671650 11:44945861-44945883 GGGAGGGACCGCAGCTGGAGCGG - Intronic
1081793476 11:45804765-45804787 GCGAGTCTCCGGAGGTGGAGGGG + Exonic
1081810240 11:45910305-45910327 GAGCGGCCCTGCAGTGGGAGAGG + Intronic
1083329518 11:61891078-61891100 CTAAGGCCCCACAGGTGGAGCGG + Intronic
1084499225 11:69525077-69525099 GAGAGGCTGCACAGGTAGAGAGG + Intergenic
1085046714 11:73357793-73357815 GACAGACGCCGCAGGAGGAGCGG - Intronic
1089157253 11:116411932-116411954 GCGAGGCCGGGCAGGTGCAGTGG + Intergenic
1089505731 11:118960992-118961014 GAGACGACCTGCTGGTGGAGAGG - Intergenic
1089742891 11:120597203-120597225 GAGCGGCCCCGCAAGGTGAGTGG - Intronic
1089945067 11:122462038-122462060 CTGAGGCCCTGCAGCTGGAGAGG - Intergenic
1091232444 11:133997510-133997532 GAGAGGGCCGGAAGGTGCAGAGG + Intergenic
1091312503 11:134584784-134584806 GAGAGGGCCGGCAGGTGCAGAGG - Intergenic
1091396566 12:157108-157130 GGGAGGCTCAGAAGGTGGAGCGG + Exonic
1094753365 12:33439158-33439180 GAGAAGCCCGGCAGGTGGACAGG + Intronic
1095947588 12:47762372-47762394 GAGAGGCAGAGCAGGAGGAGAGG - Intronic
1096115346 12:49051835-49051857 GGGAGACTCCTCAGGTGGAGGGG + Exonic
1096781852 12:53996359-53996381 GAGAGACCCCTGAGGGGGAGGGG - Intronic
1097233543 12:57525882-57525904 GAGGGGCCCCCACGGTGGAGGGG + Exonic
1097863753 12:64542998-64543020 GCGGGGCCCCGCACTTGGAGTGG + Intergenic
1098299868 12:69043184-69043206 CAGGGACCCAGCAGGTGGAGAGG + Intergenic
1100713645 12:97283513-97283535 GAGGGACCCTGCAGGAGGAGGGG + Intergenic
1102043317 12:109814709-109814731 GAGTGGCACCCCAGGTGGGGAGG - Exonic
1102149379 12:110678217-110678239 GAGGGGTCCCGCAGGAGGAGGGG - Intronic
1102416157 12:112764645-112764667 GAGAGGCAGGGAAGGTGGAGAGG - Intronic
1102502243 12:113360395-113360417 GCGAGGCCCAGCATGGGGAGGGG + Intronic
1103942069 12:124506580-124506602 GAGAAGCCCTGCACGGGGAGCGG + Intronic
1105472252 13:20704313-20704335 GCGGGGCCCGGCAGGTGGGGAGG + Intronic
1110286391 13:73754435-73754457 GAGAGGGCCAGCAGCAGGAGAGG - Intronic
1110532365 13:76612141-76612163 GAGAGGCCAGGTAGGTGCAGTGG + Intergenic
1114412923 14:22517617-22517639 GACAGGCTCCCCATGTGGAGGGG + Intergenic
1114635236 14:24183431-24183453 GAGCGGGCCGGCGGGTGGAGTGG - Intronic
1115429511 14:33300584-33300606 GAGGGGACCCACAGGAGGAGTGG + Intronic
1120190577 14:81436252-81436274 GAGGGGCCCCGCAGGTGGAGCGG - Intronic
1121308830 14:92923855-92923877 GAGAGACCCCAGAGGTGGGGGGG - Intronic
1121718375 14:96092202-96092224 GAGAGGCTGCGTAGGTGGTGCGG + Exonic
1122076982 14:99242343-99242365 GAGAGGCCCGTCAGGTTGGGAGG + Intronic
1122875814 14:104664412-104664434 GAGAGGGGCTGCAGGTGGGGTGG - Intergenic
1124093104 15:26624555-26624577 GAGAGGCGCTGCTGGTGGTGCGG - Intronic
1129385906 15:75196001-75196023 GAGAGGCCCTGGATGGGGAGAGG + Intronic
1130093449 15:80839648-80839670 GAGAGCCCCTGCAGGCTGAGAGG + Intronic
1131022058 15:89107127-89107149 GAGAAGCCCCTCAGCAGGAGAGG + Intronic
1131265282 15:90911929-90911951 CAGAGGCCCAGCGGGTGCAGGGG + Intronic
1132400635 15:101502820-101502842 GTGAGGCCCAGGAGGTGGAGTGG - Intronic
1132690726 16:1180772-1180794 GGGAGGCCCCTTAGGTGAAGAGG + Intronic
1132748033 16:1445106-1445128 CAGAGGCGCTCCAGGTGGAGGGG - Exonic
1133078217 16:3295833-3295855 GAGAGATCCAGGAGGTGGAGCGG + Intronic
1133751644 16:8730538-8730560 GAGAGATCCCACAGCTGGAGGGG - Intronic
1136375744 16:29864065-29864087 GAGAGGCCCACCAGGCGAAGGGG + Intergenic
1137256333 16:46778263-46778285 GAGAGGCCAGGCAGTGGGAGCGG - Intronic
1137607661 16:49797247-49797269 GGGAGGCCAAGCAGGTAGAGCGG + Intronic
1138086096 16:54135065-54135087 GAGAGGCATCCAAGGTGGAGCGG - Intergenic
1139388046 16:66586982-66587004 AAGAGGTCCTGAAGGTGGAGAGG - Exonic
1139558241 16:67726298-67726320 GAAAGGCCAGGCAGGAGGAGTGG + Exonic
1141552821 16:84817564-84817586 CATAGGCCCAGCAGGTGGAACGG - Intergenic
1142189144 16:88709615-88709637 GAAGGGCCCAGCTGGTGGAGTGG - Intronic
1142417869 16:89952847-89952869 GACAGGCCCCATAGGTGGTGTGG + Intronic
1143163736 17:4887179-4887201 GGTAGGCCTGGCAGGTGGAGTGG + Exonic
1143767101 17:9144991-9145013 GGGAGGGCCAGAAGGTGGAGCGG + Intronic
1143770155 17:9163313-9163335 GAGAAGCCCAGGAGGGGGAGGGG - Intronic
1143866181 17:9925729-9925751 GAGAGGCCCAGCAGCCAGAGTGG + Intronic
1144630570 17:16870161-16870183 AAGGGGCCCAGCAGCTGGAGTGG - Intergenic
1144650755 17:17005294-17005316 AAGGGGCCCAGCAGCTGGAGTGG + Intergenic
1144665270 17:17098257-17098279 GAGGGGCCTTGGAGGTGGAGTGG - Intronic
1145251443 17:21298938-21298960 GAGAGGCCCTGCAGGGGTGGCGG - Intronic
1148798710 17:50210056-50210078 CTGAGGCCCAGAAGGTGGAGGGG + Intergenic
1149702991 17:58671010-58671032 GAGAGTTCCAGAAGGTGGAGTGG - Intronic
1150106190 17:62464357-62464379 GGGAGGCCAGGAAGGTGGAGGGG + Intronic
1151453152 17:74211600-74211622 CAGAGGCCCCCCAGGTGGGAAGG - Intergenic
1152155304 17:78629087-78629109 TAGAGGACTTGCAGGTGGAGTGG - Intergenic
1152373283 17:79903893-79903915 GAGAGAACCCACAGGTGGAAGGG - Intergenic
1152610209 17:81311652-81311674 GACAGGCCTGGCAGGTGGACCGG - Exonic
1152648657 17:81481938-81481960 GAGAGACCCCCAAGCTGGAGAGG + Intergenic
1152739482 17:82012707-82012729 GAGAGGCCGGGCAGGGGGAAGGG - Intronic
1152879884 17:82808689-82808711 GAGAGGCCCCTGCTGTGGAGGGG + Intronic
1152918185 17:83052503-83052525 GCGAGGTCCCCCAGGAGGAGGGG + Intergenic
1152918264 17:83052707-83052729 GCGAGGTCCCCCAGGAGGAGGGG + Intergenic
1152918306 17:83052809-83052831 GCGAGGTCCCCCAGGAGGAGGGG + Intergenic
1152918347 17:83052911-83052933 GCGAGGTCCCCCAGGAGGAGGGG + Intergenic
1154134285 18:11762104-11762126 GGGAGGCACAGGAGGTGGAGAGG + Intronic
1159685809 18:71418490-71418512 GAGGGGTCCAGCAGGTGGAGAGG + Intergenic
1160045783 18:75386154-75386176 GAGAGTGGCTGCAGGTGGAGGGG + Intergenic
1160231896 18:77055056-77055078 GGGAGGCCCCGCAGTTAGAAGGG + Intronic
1160682427 19:417957-417979 GGGAGGGCCGGCAGGGGGAGGGG - Intronic
1160817912 19:1044752-1044774 AACAGACCCCGCAGGTGGACAGG - Intronic
1160838735 19:1136924-1136946 TGGATGCCCGGCAGGTGGAGAGG + Intronic
1162185601 19:8902209-8902231 GAGAGGGCCAGCAGCTGTAGTGG + Exonic
1162185979 19:8905056-8905078 GAGAGGGCCAGCAGCTGTAGTGG + Exonic
1162186361 19:8907872-8907894 GAGAGGGCCAGCAGCTGTAGTGG + Exonic
1162959430 19:14117408-14117430 GAGGGGCCCCGTAGGGGGAGGGG + Intronic
1163153170 19:15426861-15426883 GGGAGGACACGCAGGTAGAGAGG - Intronic
1163536206 19:17878058-17878080 GAGATGCGCCCCAGGAGGAGAGG - Exonic
1163623300 19:18373545-18373567 GAGAGGCTCAGCAGTTGGAATGG - Intergenic
1163787021 19:19279972-19279994 GAGAGGCCACTCAGGTGCAGTGG + Intronic
1164387985 19:27793427-27793449 GAGTGGCCCCTCAGGAGGAAGGG + Intergenic
1165210444 19:34231537-34231559 GAGGGGCCCTGCAGAAGGAGCGG - Intergenic
1165384650 19:35503187-35503209 AGGAGGCCCGGCAGGTGGAAAGG - Intronic
1166656835 19:44618421-44618443 GTGGGGCCCCGCAGTGGGAGGGG + Intronic
1167795512 19:51705631-51705653 GAGAGGCCAAGGAGGTGGTGGGG - Intergenic
1168288875 19:55347461-55347483 GGGAGGCCCAGCAGGGAGAGAGG + Exonic
1168338980 19:55613242-55613264 TAGAGGGCCTGCAGGTGGTGTGG + Intronic
926036965 2:9643501-9643523 GGGAGGCCCCGCAGGGAGGGTGG - Intergenic
926737126 2:16082166-16082188 GAGGGGCTGCCCAGGTGGAGTGG + Intergenic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928947614 2:36785966-36785988 GAGAAGCTCTGTAGGTGGAGAGG - Intronic
929157981 2:38804851-38804873 GAGGGGCCCTGCACGTGGGGTGG - Intronic
933760527 2:85668903-85668925 GAGAGCCCCTGCAGCTGCAGAGG - Intergenic
935846034 2:107166562-107166584 CAGTGGCCCCGGAGGTGCAGAGG - Intergenic
936489345 2:112957050-112957072 AAGAGCCCCTGGAGGTGGAGAGG - Intergenic
937217772 2:120323578-120323600 GAGAGGCCGTGGAGGAGGAGGGG - Intergenic
937996097 2:127696102-127696124 CAGCTGCCCCGCAGGTGCAGAGG + Intergenic
938639662 2:133266089-133266111 GCGAGGCCCCACAGGTGGAGAGG + Intronic
938817419 2:134918581-134918603 GGGAGGCGCCGAAGGTGGAGAGG - Intronic
942105481 2:172629356-172629378 CACAGGCCCCACTGGTGGAGTGG + Intergenic
943342107 2:186694012-186694034 AAGAGGCCCGGGAGGCGGAGGGG - Exonic
945045309 2:205776445-205776467 GAGGGGCCCCGTTGGTGTAGTGG - Intronic
946581920 2:221138289-221138311 GAGAGGCCCTGACGATGGAGGGG - Intergenic
947913758 2:233819057-233819079 GACAGGCCCTGCACGTGGTGTGG + Intronic
948675518 2:239594474-239594496 GAGAGGCCTCGTAGGTGGTCAGG + Intergenic
948941288 2:241198127-241198149 GAAAGGCACGGAAGGTGGAGGGG - Intronic
949048717 2:241885391-241885413 CAGAGGCGCCCCAGGTGGGGAGG + Intergenic
1172697439 20:36832307-36832329 GGGCATCCCCGCAGGTGGAGAGG - Intronic
1173571496 20:44079726-44079748 GAGAGACCCCAGAGGTGGACAGG - Intergenic
1173861393 20:46286063-46286085 GAGAGGGCTGGCAGGTGGTGGGG + Intronic
1174648487 20:52105139-52105161 AGGTGGCCCCGCAGGTGGCGGGG - Intronic
1174718811 20:52789041-52789063 GAGAGGCACCGGAGGAGGAGCGG - Intergenic
1175001398 20:55633582-55633604 GAGAAGCCCTGCAGTGGGAGAGG + Intergenic
1175001430 20:55633729-55633751 GAGAAGCCCTGCAGTGGGAGAGG + Intergenic
1176271903 20:64239696-64239718 GAGAGGACCCCCAGGAGGATGGG + Intronic
1179627013 21:42654347-42654369 GCGGGGCCCCGGAGGTGCAGCGG - Intronic
1179990699 21:44946959-44946981 GAGTAGCCCCACAGGCGGAGGGG + Intronic
1180990672 22:19933865-19933887 GCCAAGCCCTGCAGGTGGAGAGG - Intronic
1181041586 22:20195024-20195046 GGGAGGGCCTGCAGGGGGAGGGG - Intergenic
1181085268 22:20436856-20436878 GACAGGCCCGGCCGGTGGGGGGG - Intronic
1181687085 22:24536854-24536876 GTGAGGACCCACAGGTAGAGTGG + Intergenic
1182842888 22:33406275-33406297 GGGAAGACCTGCAGGTGGAGGGG - Intronic
1183622460 22:38982481-38982503 GAGGGGCCCAGCAGGCAGAGTGG - Intronic
1183632344 22:39040988-39041010 GAGGGGCCCAGCGGGTAGAGCGG - Intronic
1183668062 22:39256472-39256494 CAGAGGCCCCGGGGGTGGACAGG + Intergenic
1184236026 22:43183488-43183510 GAGAGGCCCCAAAGGCAGAGAGG + Intronic
1184241403 22:43212888-43212910 AAGGGGACCCACAGGTGGAGGGG + Intronic
1184362615 22:44027288-44027310 GAGAGGCCCTGTAGGTCCAGTGG + Intronic
1184410999 22:44326403-44326425 GAGATGCCCAGCAGAGGGAGGGG - Intergenic
1184610087 22:45597840-45597862 GAAAGGCCCAGCAGCTGGGGTGG - Intronic
1185234792 22:49705415-49705437 GAGAGGCCAAGAAGGCGGAGGGG + Intergenic
949575235 3:5332393-5332415 GCCAGGGCCTGCAGGTGGAGAGG + Intergenic
950401031 3:12769145-12769167 GGTAGGCCCCGCACTTGGAGAGG - Intronic
954363257 3:50133524-50133546 GAGAGCTCCAGCAGGGGGAGGGG - Intergenic
954442325 3:50528520-50528542 CAGAGGCCCAGAAGGTGGAATGG + Intergenic
955195582 3:56802096-56802118 GGGCGGTCCCGCGGGTGGAGAGG + Intronic
956106517 3:65824433-65824455 GAGGGGCCCAGCAGGTATAGAGG + Intronic
957041493 3:75338987-75339009 GAGAGGCCCTGCAGGAAGATGGG + Intergenic
961046204 3:123709809-123709831 GAGAGGCCCTGCAGGAAGATGGG + Exonic
961074707 3:123971502-123971524 GAGAGGACCCCCAGGGGCAGAGG - Intronic
961449296 3:126995251-126995273 GAGAGGCACCCCAGGGGGAGAGG - Intronic
961636357 3:128335432-128335454 GAGAGGAACTGCAGGTGCAGAGG + Intronic
961654288 3:128432922-128432944 GACCGACCCCGCAGGTGGCGCGG - Intergenic
967126974 3:186432917-186432939 GAGAACCCCCACAGGAGGAGGGG - Intergenic
967852524 3:194093191-194093213 GAGAGGCCGCGGCGGTGGGGGGG - Intergenic
967932802 3:194702674-194702696 GAGAGGCAGCGGAGGTGGAGAGG + Intergenic
968229854 3:196999111-196999133 GAGAGGCCACCGAGGTGGTGTGG - Intronic
968613884 4:1568770-1568792 GGGAGGCGGCGCGGGTGGAGTGG - Intergenic
968662246 4:1803475-1803497 CAGAGGACTCGCCGGTGGAGGGG + Intronic
968693575 4:2009061-2009083 CAGAGGCGGCGCAGGTGGCGCGG + Exonic
968880242 4:3294880-3294902 GAAAGGCCCCTCACGTGGACTGG + Intronic
968939438 4:3630407-3630429 GAGGGGCGCCTCAGGGGGAGGGG + Intergenic
969219711 4:5751850-5751872 GGAAGGCCCCGCATGTGCAGAGG + Intronic
969489831 4:7492837-7492859 CAGAGGCTCCGCAGGTGCACGGG - Intronic
969822508 4:9731295-9731317 CTGAGGCCCAGCAGGTGCAGGGG - Intergenic
970322586 4:14889571-14889593 GAGATGCCTGCCAGGTGGAGAGG - Intergenic
971370404 4:26014578-26014600 GACAAGCCCAGCAGGTGGAATGG + Intergenic
972794346 4:42400360-42400382 GAGAGGCACGGCAGCTGGAGTGG + Intronic
974962781 4:68724559-68724581 CAGAGGCCAGGCAGGTGCAGAGG + Intergenic
975473391 4:74794691-74794713 GTGAGACCCAGCAGGGGGAGTGG - Intergenic
976587686 4:86816886-86816908 GTGAGGCCACGCAGCTGGGGTGG + Intergenic
977744723 4:100532739-100532761 GAGAGGCCACTGTGGTGGAGAGG - Intronic
980824120 4:138053184-138053206 GACAGGCCCCGCACTGGGAGGGG - Intergenic
985638586 5:1052599-1052621 GAGAGACCCCCCAGGCGGGGAGG + Intronic
985971458 5:3381531-3381553 GAGCTGCCCCGCAGGTGGAATGG - Intergenic
986749719 5:10776136-10776158 TAGAGGCCCCACAGCAGGAGTGG + Intergenic
987020324 5:13863837-13863859 CAGAGGCCAGGGAGGTGGAGTGG - Intronic
990239199 5:53799776-53799798 CAGCGGCCCAGCAGGGGGAGGGG + Intergenic
993703429 5:91144042-91144064 GAGAGGCCAGGCAGTGGGAGCGG + Intronic
997660102 5:135582773-135582795 GAGGAGCACTGCAGGTGGAGGGG - Intergenic
998158435 5:139799429-139799451 GAGAGGCACAGCAAGGGGAGAGG + Intronic
999297997 5:150472601-150472623 GTGAGCCCCCACAGGTGGTGTGG - Intergenic
1000405397 5:160882334-160882356 GAGAGGCCAGGCATGTGTAGGGG + Intergenic
1001131234 5:169065432-169065454 GAGGGGCCGCCCAAGTGGAGGGG - Intronic
1001901161 5:175431059-175431081 GAGAGGGCACGGAGGAGGAGAGG - Intergenic
1002140240 5:177133535-177133557 GAGCGGGCGCGCAGGGGGAGGGG + Intronic
1002666882 5:180831594-180831616 GAGAGGCCCAGCAGGGGGCGGGG + Intergenic
1003097804 6:3156381-3156403 GAGGGGCCCTGGAGGAGGAGGGG + Intronic
1003101534 6:3179939-3179961 GAGGGGCCCTGGAGGAGGAGGGG + Intergenic
1004248440 6:14002503-14002525 GCTAGGCCCCGCAGTCGGAGCGG + Intergenic
1004546558 6:16603737-16603759 GTGAGGCACAGCAGGTGAAGTGG + Intronic
1004615155 6:17281844-17281866 GAGGAGCCCCGCGGGTAGAGCGG + Intronic
1004694372 6:18020097-18020119 GGCAGGCCCCGCAGTTGGAGCGG + Intergenic
1005433410 6:25782264-25782286 GAGAGGCCCTGCAGGTTGCCTGG + Intergenic
1006455252 6:34128163-34128185 AAGAGGCCCAGCAGATGGTGGGG + Intronic
1007092258 6:39191547-39191569 GGAAGGCCCTGCAGGTGAAGGGG - Exonic
1007709973 6:43816639-43816661 GAGAGGAGGTGCAGGTGGAGAGG + Intergenic
1010020678 6:71156296-71156318 GAGAGGCCCTGTTGATGGAGTGG + Intergenic
1011155130 6:84321940-84321962 GGGAGGCACAGTAGGTGGAGTGG + Intergenic
1016339728 6:143049704-143049726 GAGAGGCCAGGCAGTGGGAGTGG + Intergenic
1017043259 6:150324730-150324752 GACAGGCCCAGCAGCTGGTGGGG + Intergenic
1017207796 6:151822625-151822647 GAGAGCTCCAGCAGGTGGAGAGG + Intronic
1018337781 6:162814149-162814171 GAGAGGCCCTCCAGCTGCAGGGG + Exonic
1019292978 7:259257-259279 GAGGGGCCCGGCAGGAGGATGGG - Intronic
1020552293 7:9621730-9621752 GACAGGCCCCGCACTCGGAGCGG - Intergenic
1021841199 7:24723180-24723202 GAGAGGCCCCACAGGGACAGCGG + Intronic
1022282687 7:28926995-28927017 GAGAGGGCTCGCAGGAGGAAGGG + Intergenic
1023821246 7:43981790-43981812 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1023937486 7:44749676-44749698 GAGAGACACGGTAGGTGGAGGGG - Intronic
1024543903 7:50501214-50501236 GAGAGGACGTGCAGCTGGAGGGG - Intronic
1025082568 7:55996362-55996384 GAAAGGCGCTTCAGGTGGAGGGG - Intronic
1025712460 7:63925785-63925807 GAGAGGCCCCTCAGTGGGAACGG + Intergenic
1029694565 7:102204382-102204404 GACAGGCCCAGCACCTGGAGTGG - Exonic
1029749515 7:102535214-102535236 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1029767463 7:102634317-102634339 GAGGGGCCCCGCAGGAGCAGGGG - Intronic
1032035256 7:128516945-128516967 GGGAGGCCAGGAAGGTGGAGGGG + Intergenic
1032316086 7:130840431-130840453 GAGAGGAGCCGCATGTGGAACGG - Intergenic
1034342819 7:150368988-150369010 CACGCGCCCCGCAGGTGGAGCGG - Intronic
1035463922 7:159063424-159063446 GGTAGGCCCCGCACTTGGAGCGG - Intronic
1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG + Intronic
1038473003 8:27841121-27841143 GAAAGGCCCCAGAGGTGGAGGGG - Intergenic
1038499168 8:28029209-28029231 GAGAGGCTCCGGGGGAGGAGAGG - Intronic
1040583435 8:48716270-48716292 GGCAGGCCCCGCACTTGGAGCGG - Intronic
1047642394 8:126834391-126834413 GAGATGCCCTGCAGATGGAGTGG + Intergenic
1048332773 8:133482408-133482430 GAGAGGCCCCAGAGGTGCCGAGG + Intronic
1048944149 8:139428870-139428892 TAGGGGACCCTCAGGTGGAGAGG + Intergenic
1049614114 8:143568889-143568911 GAGAGCCCCTGCAGGGGGTGGGG + Intronic
1049838587 8:144755566-144755588 CTGAGGCCCCGCAGGGGGCGGGG - Exonic
1050472304 9:6007051-6007073 GAGAAGCCCGGGAGGAGGAGCGG - Intronic
1050530075 9:6581028-6581050 GAGAACACCCTCAGGTGGAGAGG - Intronic
1051816149 9:21107599-21107621 GAGTGGCCCCGTAGCTGGAAAGG + Intergenic
1052159335 9:25235627-25235649 GAGAGGTGCCAGAGGTGGAGAGG - Intergenic
1054814985 9:69466181-69466203 CAGAGGCCCAGCAGCAGGAGCGG + Intronic
1056481519 9:87011632-87011654 GGGAGCGCCCGCAGGGGGAGGGG - Intergenic
1057551029 9:96050940-96050962 GTGAGGCCCCGCCCGTGGTGAGG - Intergenic
1057792322 9:98132390-98132412 GGGAGGCCTCCCAGGTGGAGCGG - Intronic
1058091828 9:100814051-100814073 GAGAGGCCAGGCAGTAGGAGTGG - Intergenic
1059329945 9:113528608-113528630 CAGATGCCTCCCAGGTGGAGGGG + Intronic
1059671076 9:116493212-116493234 CAGAGGCCTCCCAGGTAGAGTGG - Intronic
1059975804 9:119715742-119715764 CAGAGGCAGGGCAGGTGGAGAGG + Intergenic
1060554320 9:124500477-124500499 CAGTGGCCCAGCAGGTGGACCGG + Exonic
1061230407 9:129312587-129312609 GAGAAGCCCTGCTGCTGGAGGGG + Intergenic
1061280819 9:129597008-129597030 GGGAGGCCCCACAGGAAGAGAGG + Intergenic
1061313378 9:129778394-129778416 GACAGGCCCCAGGGGTGGAGAGG + Intergenic
1061586305 9:131571247-131571269 GAGCTGCCCTGCAGGTGGAAGGG - Intergenic
1062026882 9:134344603-134344625 CAGAGGCCCGGGAGGTGGGGAGG - Intronic
1062350622 9:136136970-136136992 GAGAGGGCCCAGAGGTGGAGAGG + Intergenic
1062351648 9:136142549-136142571 GGGAGCCCCAGGAGGTGGAGAGG - Intergenic
1062372548 9:136247472-136247494 GAGAGGCAGTGCTGGTGGAGGGG + Intergenic
1203361372 Un_KI270442v1:221001-221023 GAGAGGATCCGCGGGTGGGGAGG + Intergenic
1203549162 Un_KI270743v1:153823-153845 GTGGGGCCCGGCATGTGGAGAGG + Intergenic
1185450804 X:280276-280298 GGGAGGCCGTGCAGGAGGAGGGG + Intronic
1185450821 X:280316-280338 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185450867 X:280436-280458 GGGAGGCCGTGCAGGAGGAGGGG + Intronic
1185450882 X:280476-280498 GGGAGGCCGTGCAGGCGGAGGGG + Intronic
1185450931 X:280597-280619 GGGAGGCCGTGCAGGCGGAGGGG + Intronic
1185450955 X:280658-280680 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185450988 X:280738-280760 GGGAGGCCGTGCAGGCGGAGGGG + Intronic
1185451004 X:280778-280800 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185451013 X:280798-280820 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185451022 X:280818-280840 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185451045 X:280878-280900 GGGAGGCCGTGCAGGCGGAGGGG + Intronic
1185451089 X:280979-281001 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185451098 X:280999-281021 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185451107 X:281019-281041 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185451125 X:281058-281080 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1185451134 X:281078-281100 GGGAGGCCGTGCAGGGGGAGGGG + Intronic
1189522969 X:41789489-41789511 GGAAGGCCCCGCAGGAGGGGAGG + Intronic
1189566125 X:42242968-42242990 GAGAGGCCCAGCAGGTATTGAGG + Intergenic
1190934025 X:54978057-54978079 GAGAGGCTATGCATGTGGAGGGG + Intronic
1198078036 X:133212971-133212993 GAGAGGCCCAGCACTTTGAGAGG + Intergenic
1200002280 X:153068274-153068296 TAGAGCCCCAGAAGGTGGAGTGG - Intergenic
1200418188 Y:2935199-2935221 GAGAGGCCCACCGGGCGGAGGGG + Intronic
1201077072 Y:10196559-10196581 GAGAGGATCCGCGGGTGGGGTGG - Intergenic