ID: 1062843528

View in Genome Browser
Species Human (GRCh38)
Location 10:688878-688900
Sequence GATCCCACCCCCATTGTTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062843528_1062843536 6 Left 1062843528 10:688878-688900 CCGCGAACAATGGGGGTGGGATC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1062843536 10:688907-688929 GCCGCGCCAGGACCGCTGCACGG No data
1062843528_1062843531 -6 Left 1062843528 10:688878-688900 CCGCGAACAATGGGGGTGGGATC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1062843531 10:688895-688917 GGGATCCCCCGGGCCGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062843528 Original CRISPR GATCCCACCCCCATTGTTCG CGG (reversed) Intronic
902492222 1:16791454-16791476 GCTCCGACCCTCATTGTTCAAGG - Intronic
904074321 1:27828950-27828972 GATCCCACTCCACTTGTTCTAGG + Intergenic
908199535 1:61780058-61780080 AATCTCATCCCCATTGTTTGAGG - Intronic
911881293 1:103241477-103241499 TATACCCCCACCATTGTTCGTGG - Intergenic
912273049 1:108229577-108229599 CATCCCAGCCCCCTTTTTCGTGG - Intronic
912295171 1:108464745-108464767 CATCCCAGCCCCCTTTTTCGTGG + Intronic
917136374 1:171792018-171792040 GATCCCACTGGCATTGTTGGTGG + Exonic
923528225 1:234791083-234791105 GCTCCGACCCTCATTGTTCAAGG + Intergenic
924836948 1:247659043-247659065 GAACCCACACACATTGTTGGTGG - Intergenic
1062843528 10:688878-688900 GATCCCACCCCCATTGTTCGCGG - Intronic
1068139751 10:52990939-52990961 AATGCCACCCCCAGTGTTGGAGG - Intergenic
1074851011 10:117439729-117439751 GGCCCCAGCCCCATTGTTCTTGG + Intergenic
1079081273 11:17415186-17415208 GACCCCAGCCCCAGTGTTGGGGG - Intronic
1080033622 11:27688339-27688361 GATCCCACCCCCATGGAGCACGG - Intronic
1085055264 11:73399454-73399476 AAACCCACCCCCAGTGTCCGAGG - Intergenic
1086033450 11:82388016-82388038 GAACCCTCCCACATTGTTGGTGG + Intergenic
1086509929 11:87544971-87544993 GACCCCACCTCCAATGTTGGGGG + Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1094712448 12:32978563-32978585 GATCCCACCCCCAGTGCTGGAGG + Intergenic
1101921845 12:108939366-108939388 AATCTCACCCCCATTGTTCAAGG + Intronic
1105277873 13:18946832-18946854 GCTGCCACCCCCATTCTTCTGGG + Intergenic
1106242416 13:27921958-27921980 GAGCCCCCCACCTTTGTTCGAGG - Intronic
1112195215 13:97219126-97219148 GATCCCATCTCCATAGTTCTTGG - Intergenic
1112549130 13:100403591-100403613 GAATCCACCCCCATTGTTGCAGG + Intronic
1124710391 15:32005404-32005426 GATTCTAACCCCATTGTTCTGGG - Intergenic
1128850277 15:70947894-70947916 GATCCCACACCCATTGTCCTAGG - Intronic
1129515007 15:76152067-76152089 GATCCCACCCCCAGTCTCCATGG + Intronic
1138131356 16:54482673-54482695 AATCACACCCCCATTCTTCCTGG - Intergenic
1156355091 18:36333747-36333769 GATCCCACCCCCAGAGTTTCAGG - Intronic
1157925533 18:51761516-51761538 GAGCCCTCACCCATTGTTGGTGG - Intergenic
1158566904 18:58561726-58561748 ACTCCCACCCCCATTGGTGGAGG + Intronic
1168358728 19:55719845-55719867 CCTCCCACCCCCATTGTGTGTGG - Intronic
927517914 2:23682744-23682766 GCTCCCACCCCCCTTGCTCCGGG + Intronic
930979151 2:57500874-57500896 GATGCCACCCCTCTTGTTCCTGG - Intergenic
934920096 2:98336077-98336099 CATCCCACCCCCCTTTTTAGTGG + Intronic
936547908 2:113408677-113408699 GATACCACCCCCATTTTTCCTGG + Intergenic
936800879 2:116263992-116264014 GATCACACATACATTGTTCGTGG + Intergenic
939781512 2:146456029-146456051 GACCCCACCTACATTGTTAGTGG + Intergenic
941855399 2:170226066-170226088 GATCCCACCCTCATTGCTTGTGG - Intronic
1170766145 20:19291314-19291336 CAGGCCACCCCCATTGTTCATGG - Intronic
1181162686 22:20967353-20967375 GATGTCACCCCCATTGTAGGAGG + Intronic
1184659321 22:45958693-45958715 GAACCCACCCCCACTGTCCCGGG + Intronic
1184870006 22:47231841-47231863 GTTCCTACCCCCATTCTTCTGGG + Intergenic
951938459 3:28050683-28050705 GAACCCACCCCCATTCCTGGTGG - Intergenic
968756231 4:2417828-2417850 GCCCCCACCCCCATTGTCCTGGG - Intronic
970353349 4:15228171-15228193 GTGTCCACCCACATTGTTCGTGG + Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
977261611 4:94803392-94803414 GACTCCACCCCCAGTGTTAGGGG + Intronic
991932223 5:71765244-71765266 GATCCCACGGCCATTGTTAGGGG - Intergenic
993307510 5:86290384-86290406 CATCCCAGCCCCCTTTTTCGTGG + Intergenic
1001683405 5:173575398-173575420 GGTCCCAACCCCATTCTTGGTGG + Intergenic
1007594990 6:43045812-43045834 CATGCCACCCTCATTGTTCAGGG + Intronic
1012874105 6:104705594-104705616 GAGTCCAGCACCATTGTTCGAGG - Intergenic
1013699701 6:112750290-112750312 GTGCCCACCCACATTGTTAGTGG + Intergenic
1019616465 7:1965135-1965157 GTTCCCACACCCGTTGTTCAAGG - Intronic
1025098130 7:56113309-56113331 GATCCCACAACAATTTTTCGAGG - Intergenic
1028983945 7:96995739-96995761 CATCCCACCCCCCATGTTTGGGG + Intergenic
1033261972 7:139851857-139851879 GCTCCCTCCCCCATTGTACCAGG + Intronic
1033625210 7:143104441-143104463 GACCCCACCCCCATTGGCCAAGG + Intergenic
1045862586 8:106829786-106829808 GTTCCCTCCCACATTGTTCCAGG + Intergenic
1049654514 8:143791821-143791843 GACCCCACCCCCATGCCTCGGGG + Intronic
1054865161 9:69992780-69992802 GCTACCAACCCCATTGTTTGTGG + Intergenic
1060626643 9:125119135-125119157 GATCCCATCTCTATTGTTGGCGG + Intronic
1062683673 9:137798987-137799009 GGTCCCACCCCCATTCTCCATGG + Intronic
1193450196 X:81655911-81655933 GTGCCCACCCACATTGTTAGTGG + Intergenic
1196183118 X:112716850-112716872 TATCCCAGCCCCATTGTTTATGG + Intergenic
1196520696 X:116667689-116667711 GCTCCTACCCCCATTGCTCCTGG - Intergenic