ID: 1062846190

View in Genome Browser
Species Human (GRCh38)
Location 10:707687-707709
Sequence TGGGGTGTGAAGGGCAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062846190_1062846193 -7 Left 1062846190 10:707687-707709 CCAGAATTGCCCTTCACACCCCA No data
Right 1062846193 10:707703-707725 CACCCCATTCATAGCAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062846190 Original CRISPR TGGGGTGTGAAGGGCAATTC TGG (reversed) Intergenic