ID: 1062846193

View in Genome Browser
Species Human (GRCh38)
Location 10:707703-707725
Sequence CACCCCATTCATAGCAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062846184_1062846193 20 Left 1062846184 10:707660-707682 CCCCACTCCTTTTCTTCTGAGCC No data
Right 1062846193 10:707703-707725 CACCCCATTCATAGCAATCCAGG No data
1062846189_1062846193 -2 Left 1062846189 10:707682-707704 CCTCACCAGAATTGCCCTTCACA No data
Right 1062846193 10:707703-707725 CACCCCATTCATAGCAATCCAGG No data
1062846186_1062846193 18 Left 1062846186 10:707662-707684 CCACTCCTTTTCTTCTGAGCCCT No data
Right 1062846193 10:707703-707725 CACCCCATTCATAGCAATCCAGG No data
1062846185_1062846193 19 Left 1062846185 10:707661-707683 CCCACTCCTTTTCTTCTGAGCCC No data
Right 1062846193 10:707703-707725 CACCCCATTCATAGCAATCCAGG No data
1062846187_1062846193 13 Left 1062846187 10:707667-707689 CCTTTTCTTCTGAGCCCTCACCA 0: 3
1: 19
2: 36
3: 98
4: 560
Right 1062846193 10:707703-707725 CACCCCATTCATAGCAATCCAGG No data
1062846188_1062846193 -1 Left 1062846188 10:707681-707703 CCCTCACCAGAATTGCCCTTCAC No data
Right 1062846193 10:707703-707725 CACCCCATTCATAGCAATCCAGG No data
1062846190_1062846193 -7 Left 1062846190 10:707687-707709 CCAGAATTGCCCTTCACACCCCA No data
Right 1062846193 10:707703-707725 CACCCCATTCATAGCAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062846193 Original CRISPR CACCCCATTCATAGCAATCC AGG Intergenic
No off target data available for this crispr