ID: 1062846851

View in Genome Browser
Species Human (GRCh38)
Location 10:714149-714171
Sequence ATGAGGCCGTTCCTCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062846848_1062846851 23 Left 1062846848 10:714103-714125 CCTAGGGGGAGAGCTGGTGTGAT No data
Right 1062846851 10:714149-714171 ATGAGGCCGTTCCTCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062846851 Original CRISPR ATGAGGCCGTTCCTCAGTGA TGG Intergenic
No off target data available for this crispr