ID: 1062848440

View in Genome Browser
Species Human (GRCh38)
Location 10:725706-725728
Sequence CTCTGGGCAGGGCTGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062848440_1062848450 19 Left 1062848440 10:725706-725728 CCAGGCAGCAGCCCTGCCCAGAG No data
Right 1062848450 10:725748-725770 AGCCCACCCAGCAGCTGCCCCGG No data
1062848440_1062848447 -4 Left 1062848440 10:725706-725728 CCAGGCAGCAGCCCTGCCCAGAG No data
Right 1062848447 10:725725-725747 AGAGCCCAGCAGGGTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062848440 Original CRISPR CTCTGGGCAGGGCTGCTGCC TGG (reversed) Intergenic
No off target data available for this crispr